National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8725R-1 
 Symbol CSN4  Full Name COP9 complex homolog subunit 4 
 CG No CG8725  Old CG No CG8725 
 Synonyms csn4, Dch4, Csn4, DCH4, Cops4, l(2)k08018, CH4, CG8725, CSN4 
 Accession No (Link to NCBI) NM_058096.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCAACTTCACTGGCACGCAC 
 Primer Seq. 3'
aatctagaggtaccTTAGTTTCGGCCTGCAGCAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCAACTTCA CTGGCACGCA CAAGGACCAG GCGGACAAGT ACCGCCAGCT GCTGAAGACT 
0061 GTGCTGACGA ACACCGGCCA AGAGCTGATC GATGGGCTCC GGCTCTTTGT GGAGGCCATT 
0121 GTAAACGAGC ACGTCAGCCT GGTGATCTCG CGGCAGATCC TTAACGACGT GGGCAGCGAG 
0181 CTGAGCAAGT TGCCTGACGA TCTGTCCAAG ATGCTTTCTC ACTTCACCCT GGAAAAGGTC 
0241 AATCCGCGCG TCATCTCGTT CGAAGAGCAA GTGGCTGGCA TACGTTTCCA CCTGGCCAAC 
0301 ATCTATGAGC GCAACCAGCA GTGGCGCGAN TGCGGCCACA GNTGCTAGTT GGCATTCCTC 
0361 TGGAGACGGG TCAGAAACAG TACTCCGTGG AGTGCAAGTT GGGCACCTAC TTAAAGATCG 
0421 CTCGACTCTA TCTGGAGGAC AACGATTCGG TGCAGGCGGA GCTGTTTCAT CAACCGGGCA 
0481 TCATTGCTGC AGGCCGAAAC TAA 
 in silico PCR Fragment
0001 ATCAACTTCA CTGGCACGCA CAAGGACCAG GCGGACAAGT ACCGCCAGCT GCTGAAGACT 
0061 GTGCTGACGA ACACCGGCCA AGAGCTGATC GATGGGCTCC GGCTCTTTGT GGAGGCCATT 
0121 GTAAACGAGC ACGTCAGCCT GGTGATCTCG CGGCAGATCC TTAACGACGT GGGCAGCGAG 
0181 CTGAGCAAGT TGCCTGACGA TCTGTCCAAG ATGCTTTCTC ACTTCACCCT GGAAAAGGTC 
0241 AATCCGCGCG TCATCTCGTT CGAAGAGCAA GTGGCTGGCA TACGTTTCCA CCTGGCCAAC 
0301 ATCTATGAGC GCAACCAGCA GTGGCGCGA- TGCGGCCACA G-TGCTAGTT GGCATTCCTC 
0361 TGGAGACGGG TCAGAAACAG TACTCCGTGG AGTGCAAGTT GGGCACCTAC TTAAAGATCG 
0421 CTCGACTCTA TCTGGAGGAC AACGATTCGG TGCAGGCGGA GCTG-TTCAT CAACCGGGCA 
0481 TCATTGCTGC AGGCCGAAAC TAA 
 Assemble Data

8725R-1.IR_full       1   ATCAACTTCACTGGCACGCACAAGGACCAGGCGGACAAGTACCGCCAGCTGCTGAAGACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8725R-1.in silico     1   ATCAACTTCACTGGCACGCACAAGGACCAGGCGGACAAGTACCGCCAGCTGCTGAAGACT 60


8725R-1.IR_full       61  GTGCTGACGAACACCGGCCAAGAGCTGATCGATGGGCTCCGGCTCTTTGTGGAGGCCATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8725R-1.in silico     61  GTGCTGACGAACACCGGCCAAGAGCTGATCGATGGGCTCCGGCTCTTTGTGGAGGCCATT 120


8725R-1.IR_full       121 GTAAACGAGCACGTCAGCCTGGTGATCTCGCGGCAGATCCTTAACGACGTGGGCAGCGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8725R-1.in silico     121 GTAAACGAGCACGTCAGCCTGGTGATCTCGCGGCAGATCCTTAACGACGTGGGCAGCGAG 180


8725R-1.IR_full       181 CTGAGCAAGTTGCCTGACGATCTGTCCAAGATGCTTTCTCACTTCACCCTGGAAAAGGTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8725R-1.in silico     181 CTGAGCAAGTTGCCTGACGATCTGTCCAAGATGCTTTCTCACTTCACCCTGGAAAAGGTC 240


8725R-1.IR_full       241 AATCCGCGCGTCATCTCGTTCGAAGAGCAAGTGGCTGGCATACGTTTCCACCTGGCCAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8725R-1.in silico     241 AATCCGCGCGTCATCTCGTTCGAAGAGCAAGTGGCTGGCATACGTTTCCACCTGGCCAAC 300


8725R-1.IR_full       301 ATCTATGAGCGCAACCAGCAGTGGCGCGANTGCGGCCACAGNTGCTAGTTGGCATTCCTC 360
                          ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||
8725R-1.in silico     301 ATCTATGAGCGCAACCAGCAGTGGCGCGA-TGCGGCCACAG-TGCTAGTTGGCATTCCTC 360


8725R-1.IR_full       361 TGGAGACGGGTCAGAAACAGTACTCCGTGGAGTGCAAGTTGGGCACCTACTTAAAGATCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8725R-1.in silico     361 TGGAGACGGGTCAGAAACAGTACTCCGTGGAGTGCAAGTTGGGCACCTACTTAAAGATCG 420


8725R-1.IR_full       421 CTCGACTCTATCTGGAGGACAACGATTCGGTGCAGGCGGAGCTGTTTCATCAACCGGGCA 480
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
8725R-1.in silico     421 CTCGACTCTATCTGGAGGACAACGATTCGGTGCAGGCGGAGCTG-TTCATCAACCGGGCA 480


8725R-1.IR_full       481 TCATTGCTGCAGGCCGAAACTAA 503
                          |||||||||||||||||||||||
8725R-1.in silico     481 TCATTGCTGCAGGCCGAAACTAA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058096.3  CG8725-RA (CSN4), mRNA 
0   NM_143052.2  CG10845-RA (CG10845), mRNA 
0   NM_176524.1  CG32491-RX, transcript variant X (mod(mdg4)), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_206297.1  CG32373-RB, transcript variant B (CG32373), mRNA 
0   NM_168229.1  CG32373-RA, transcript variant A (CG32373), mRNA 
0   NM_001038866.1  CG33981-RB, transcript variant B (CG33981), mRNA 
0   NM_137425.3  CG6355-RA, transcript variant A (CG6355), mRNA 
0   NM_168816.1  CG8522-RB, transcript variant B (HLH106), mRNA 
0   NM_079442.2  CG8522-RC, transcript variant C (HLH106), mRNA 
0   NM_168815.1  CG8522-RA, transcript variant A (HLH106), mRNA 
0   NM_169053.2  CG2663-RA, transcript variant A (CG2663), mRNA 
0   NM_141278.2  CG2663-RB, transcript variant B (CG2663), mRNA 
0   NM_079105.2  CG4084-RA (l(2)not), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_166560.1  CG30271-RC (CG30271), mRNA 
0   NM_079436.1  CG30271-RC (CG30271), mRNA, small, or homeotic discs 1 CG8887-RA (ash1), mRNA 
0   NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_167627.1  CG6659-RB, transcript variant B (CG6659), mRNA 
0   NM_001015337.1  CG40088-PA.3 (CG40088), mRNA 
0   NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
0   NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 
0   NM_206465.1  CG11992-RD, transcript variant D (Rel), mRNA 
0   NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
0   NM_142478.2  CG14303-RA (CG14303), mRNA 
0   NM_132551.2  CG1490-RB (Usp7), mRNA 
0   13  NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_139823.1  CG14825-RA (BBS1), mRNA 
0   NM_134904.2  CG3523-RA (CG3523), mRNA 
0   NM_137341.1  CG6967-RA, transcript variant A (CG6967), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.