National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8711R-2 
 Symbol cul-4  Full Name cul-4 
 CG No CG8711  Old CG No CG8711 
 Synonyms Cul-4, CUL4, Cul4, CG8711, DMcul-4, cul-4 
 Accession No (Link to NCBI) NM_136508.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCCTGAAGAAGGCCGAGAA 
 Primer Seq. 3'
aatctagaggtaccTCAGTTTGTCCATGCTACCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGCCTGAAG AAGGCCTGAG AACGTCGCCC CCNACCGCTG CTGCCGCCAT CGAGCGTGGG 
0061 CCGCAGTgCC TTCGCTGCCC AAAACATGAA TTCTGCGTCC ACCAACGGCG AGCGCCTGCC 
0121 AAACTTCTCC AAGCTAGGCG GCAGCCATGN GCGAGATCCG CACGGCTTCA ACTACCTCAA 
0181 ATCTCCTCAA TCGCATGGGG GCTATTCACA ACAGCAAGCC TGGCGATGTC AAGAAGATAG 
0241 TGATTAAGAA CTTTAAGGAT AAGCCTACAC TGCCCGATAA CTATTCCAAG GACACGTACG 
0301 TGAAGCTTGA AGAAGCCGTT ATCGCCATCC AACTCTCCAA GCCCATTAAA TATTCGCTGG 
0361 AGGAGCTCTA CCAGGCGGTG GTGAACATGT GTAGCCACAA GATGGATGCA CAATTATACG 
0421 CGAAACTCAA GGAGCTAACA GAGCAACaCG TAAAGCGCAA TATTAAGCTC AAGGAGCTCA 
0481 CCGGCGGTAG CATGGACAAA CTGA 
 in silico PCR Fragment
0001 CTGCCTGAAG AAGGCC-GAG AACGTCGCCC CC-ACCGCTG CTGCCGCC-T CGAGCGTGGG 
0061 CCGCAGTGCC TTCGCTGCCC AAAACATGAA TTCTGCGTCC ACCAACGGCG AGCGCCTGCC 
0121 AAACTTCTCC AAGCTAGGCG GCAGCCATG- GCGAGATCCG CACGGCTTCA ACTACCTCAA 
0181 ATCTCCTCAA TCGCATGGGG GCTATTCACA ACAGCAAGCC TGGCGATGTC AAGAAGATAG 
0241 TGATTAAGAA CTTTAAGGAT AAGCCTACAC TGCCCGATAA CTATTCCAAG GACACGTACG 
0301 TGAAGCTTGA AGAAGCCGTT ATCGCCATCC AACTCTCCAA GCCCATTAAA TATTCGCTGG 
0361 AGGAGCTCTA CCAGGCGGTG GTGAACATGT GTAGCCACAA GATGGATGCA CAATTATACG 
0421 CGAAACTCAA GGAGCTAACA GAGCAACACG TAAAGCGCAA TATTAAGCTC AAGGAGCTCA 
0481 CCGGCGGTAG CATGGACAAA CTGA 
 Assemble Data

8711R-2.IR_full       1   CTGCCTGAAGAAGGCCTGAGAACGTCGCCCCCNACCGCTGCTGCCGCCATCGAGCGTGGG 60
                          |||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||
8711R-2.in silico     1   CTGCCTGAAGAAGGCC-GAGAACGTCGCCCCC-ACCGCTGCTGCCGCC-TCGAGCGTGGG 60


8711R-2.IR_full       61  CCGCAGTGCCTTCGCTGCCCAAAACATGAATTCTGCGTCCACCAACGGCGAGCGCCTGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8711R-2.in silico     61  CCGCAGTGCCTTCGCTGCCCAAAACATGAATTCTGCGTCCACCAACGGCGAGCGCCTGCC 120


8711R-2.IR_full       121 AAACTTCTCCAAGCTAGGCGGCAGCCATGNGCGAGATCCGCACGGCTTCAACTACCTCAA 180
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
8711R-2.in silico     121 AAACTTCTCCAAGCTAGGCGGCAGCCATG-GCGAGATCCGCACGGCTTCAACTACCTCAA 180


8711R-2.IR_full       181 ATCTCCTCAATCGCATGGGGGCTATTCACAACAGCAAGCCTGGCGATGTCAAGAAGATAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8711R-2.in silico     181 ATCTCCTCAATCGCATGGGGGCTATTCACAACAGCAAGCCTGGCGATGTCAAGAAGATAG 240


8711R-2.IR_full       241 TGATTAAGAACTTTAAGGATAAGCCTACACTGCCCGATAACTATTCCAAGGACACGTACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8711R-2.in silico     241 TGATTAAGAACTTTAAGGATAAGCCTACACTGCCCGATAACTATTCCAAGGACACGTACG 300


8711R-2.IR_full       301 TGAAGCTTGAAGAAGCCGTTATCGCCATCCAACTCTCCAAGCCCATTAAATATTCGCTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8711R-2.in silico     301 TGAAGCTTGAAGAAGCCGTTATCGCCATCCAACTCTCCAAGCCCATTAAATATTCGCTGG 360


8711R-2.IR_full       361 AGGAGCTCTACCAGGCGGTGGTGAACATGTGTAGCCACAAGATGGATGCACAATTATACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8711R-2.in silico     361 AGGAGCTCTACCAGGCGGTGGTGAACATGTGTAGCCACAAGATGGATGCACAATTATACG 420


8711R-2.IR_full       421 CGAAACTCAAGGAGCTAACAGAGCAACACGTAAAGCGCAATATTAAGCTCAAGGAGCTCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8711R-2.in silico     421 CGAAACTCAAGGAGCTAACAGAGCAACACGTAAAGCGCAATATTAAGCTCAAGGAGCTCA 480


8711R-2.IR_full       481 CCGGCGGTAGCATGGACAAACTGA 504
                          ||||||||||||||||||||||||
8711R-2.in silico     481 CCGGCGGTAGCATGGACAAACTGA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136508.2  CG8711-RA (cul-4), mRNA 
0.2   NM_135018.1  CG2976-RA (CG2976), mRNA 
0.2   NM_079594.2  CG5242-RA (mRpL40), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0   NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
0   NM_078800.2  CG4422-RA (Gdi), mRNA 
0   NM_135559.2  CG5337-RA (CG5337), mRNA 
0   NM_169478.1  CG6148-RA, transcript variant A (Past1), mRNA 
0   NM_079608.2  CG6148-RB, transcript variant B (Past1), mRNA 
0   NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_132566.1  CG2577-RA (CG2577), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_137982.2  CG5532-RA (CG5532), mRNA 
0   10  NM_176579.1  CG33203-RC (CG33203), mRNA 
0   NM_206784.1  CG6103-RE, transcript variant E (CrebB-17A), mRNA 
0   NM_206782.1  CG6103-RD, transcript variant D (CrebB-17A), mRNA 
0   NM_206781.1  CG6103-RF, transcript variant F (CrebB-17A), mRNA 
0   NM_206783.1  CG6103-RG, transcript variant G (CrebB-17A), mRNA 
0   NM_134742.2  CG5001-RA (CG5001), mRNA 
0   NM_167152.1  CG2286-RB, transcript variant B (ND75), mRNA 
0   NM_078528.1  CG2286-RA, transcript variant A (ND75), mRNA 
0   NM_136435.2  CG30502-RA (CG30502), mRNA 
0   NM_134994.1  CG15435-RA (CG15435), mRNA 
0   NM_169125.1  CG31557-RA (Obp83ef), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   27  NM_205954.2  CG33300-RA (CG33300), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   11  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.