National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8711R-1 
 Symbol cul-4  Full Name cul-4 
 CG No CG8711  Old CG No CG8711 
 Synonyms Cul-4, CUL4, Cul4, CG8711, DMcul-4, cul-4 
 Accession No (Link to NCBI) NM_136508.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tare M, Sarkar A, Bedi S, Kango-Singh M, Singh A.
Cullin-4 regulates Wingless and JNK signaling-mediated cell death in the Drosophila eye.
Cell Death Dis (2016) 7(12) e2566 [ PubMed ID = 28032862 ] [ RRC reference ]

Strutt H, Searle E, Thomas-Macarthur V, Brookfield R, Strutt D.
A Cul-3-BTB ubiquitylation pathway regulates junctional levels and asymmetry of core planar polarity proteins.
Development (2013) 140(8) 1693-702 [ PubMed ID = 23487316 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||| silico     1   CTGCCTGAAGAAGGCC-GAGAACGTCGCCCCC-ACCGCTGCTGCCGCC-TCGAGCGTGGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCAGTGCCTTCGCTGCCCAAAACATGAATTCTGCGTCCACCAACGGCGAGCGCCTGCC 120

                          ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     121 AAACTTCTCCAAGCTAGGCGGCAGCCATG-GCGAGATCCGCACGGCTTCAACTACCTCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCTCCTCAATCGCATGGGGGCTATTCACAACAGCAAGCCTGGCGATGTCAAGAAGATAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGATTAAGAACTTTAAGGATAAGCCTACACTGCCCGATAACTATTCCAAGGACACGTACG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGAAGCTTGAAGAAGCCGTTATCGCCATCCAACTCTCCAAGCCCATTAAATATTCGCTGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGAGCTCTACCAGGCGGTGGTGAACATGTGTAGCCACAAGATGGATGCACAATTATACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGAAACTCAAGGAGCTAACAGAGCAACACGTAAAGCGCAATATTAAGCTCAAGGAGCTCA 480

8711R-1.IR_full       481 CCGGCGGTAGCATGGACAAACTGA 504
                          |||||||||||||||||||||||| silico     481 CCGGCGGTAGCATGGACAAACTGA 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136508.2  CG8711-RA (cul-4), mRNA 
0.2   NM_135018.1  CG2976-RA (CG2976), mRNA 
0.2   NM_079594.2  CG5242-RA (mRpL40), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0   NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
0   NM_078800.2  CG4422-RA (Gdi), mRNA 
0   NM_135559.2  CG5337-RA (CG5337), mRNA 
0   NM_169478.1  CG6148-RA, transcript variant A (Past1), mRNA 
0   NM_079608.2  CG6148-RB, transcript variant B (Past1), mRNA 
0   NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_132566.1  CG2577-RA (CG2577), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_137982.2  CG5532-RA (CG5532), mRNA 
0   10  NM_176579.1  CG33203-RC (CG33203), mRNA 
0   NM_206784.1  CG6103-RE, transcript variant E (CrebB-17A), mRNA 
0   NM_206782.1  CG6103-RD, transcript variant D (CrebB-17A), mRNA 
0   NM_206781.1  CG6103-RF, transcript variant F (CrebB-17A), mRNA 
0   NM_206783.1  CG6103-RG, transcript variant G (CrebB-17A), mRNA 
0   NM_134742.2  CG5001-RA (CG5001), mRNA 
0   NM_167152.1  CG2286-RB, transcript variant B (ND75), mRNA 
0   NM_078528.1  CG2286-RA, transcript variant A (ND75), mRNA 
0   NM_136435.2  CG30502-RA (CG30502), mRNA 
0   NM_134994.1  CG15435-RA (CG15435), mRNA 
0   NM_169125.1  CG31557-RA (Obp83ef), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   27  NM_205954.2  CG33300-RA (CG33300), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   11  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.