National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8696R-3 
 Symbol LvpH  Full Name Larval visceral protein H 
 CG No CG8696  Old CG No CG8696 
 Synonyms CG8696, H, V, LvpH 
 Accession No (Link to NCBI) NM_057279.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCCGGGATTCCGACGGAGAC 
 Primer Seq. 3'
aatctagaggtaccTCGTTAACCACGGCCGGATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCCGGGATT CNGACGGAGA CGGCATTGGC GACCTGAACG GGGTCACTGA AAAGCTGCAG 
0061 TACCTGAAAG ACATCGGCTT CACGGGCANC ATGGCTGTCG CCCATATTCA AGTCGCCCAT 
0121 GGTCGACTTT GGTTACGACA TATCGGACTT CTACCAGATC CATCCCGAAT ATGGAACCAT 
0181 GGAGGACTTT GAGCGAATGA TCGCCAAGGC CAAGGAGGTG GGCATCAAGA TCATCCTGGA 
0241 CTTCGTACCA AACCACTCAA GTACCGAAAA CGAATGGTTC ACCAAGTCAG TGGACAGTGA 
0301 CCCCGTCTAC AAAGACTTCT ACATCTGGCA CGATGGCAAG ATCAACAACG AGACCGGTGA 
0361 GCGGGAGCCG CCGAGCAACT GGAACTCTGA GTTTCgCTAC AGCGCCTGGG AGTGGAACGA 
0421 GGTGCGTCAG CAGTACTACC TCCACCAGTT CGCCATCCAG CAGGCCGACC TCAACTATCG 
0481 CAATCCGGCC GTGGTTAACG A 
 in silico PCR Fragment
0001 TTCCGGGATT CCGACGGAGA CGGCATTGGC GACCTGAACG GGGTCACTGA AAAGCTGCAG 
0061 TACCTGAAAG ACATCGGCTT CACGGGCA-C ATGGCTGTCG CCCATATTCA AGTCGCCCAT 
0121 GGTCGACTTT GGTTACGACA TATCGGACTT CTACCAGATC CATCCCGAAT ATGGAACCAT 
0181 GGAGGACTTT GAGCGAATGA TCGCCAAGGC CAAGGAGGTG GGCATTAAAA TCATCCTGGA 
0241 CTTCGTACCA AACCACTCAA GTACCGAAAA CGAATGGTTC ACCAAGTCTG TGGACAGTGA 
0301 CCCCGTCTAC AAAGACTTCT ACATCTGGCA CGATGGCAAG ATCAACAACG AGACCGGTGA 
0361 GCGGGAGCCG CCGAGCAACT GGAACTCTGA GTTTCGCTAC AGCGCCTGGG AGTGGAACGA 
0421 GGTGCGTCAG CAGTACTACC TCCACCAGTT CGCCATCCAG CAGGCCGACC TCAACTATCG 
0481 CAATCCGGCC GTGGTTAACG A 
 Assemble Data

8696R-3.IR_full       1   TTCCGGGATTCNGACGGAGACGGCATTGGCGACCTGAACGGGGTCACTGAAAAGCTGCAG 60
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
8696R-3.in silico     1   TTCCGGGATTCCGACGGAGACGGCATTGGCGACCTGAACGGGGTCACTGAAAAGCTGCAG 60


8696R-3.IR_full       61  TACCTGAAAGACATCGGCTTCACGGGCANCATGGCTGTCGCCCATATTCAAGTCGCCCAT 120
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
8696R-3.in silico     61  TACCTGAAAGACATCGGCTTCACGGGCA-CATGGCTGTCGCCCATATTCAAGTCGCCCAT 120


8696R-3.IR_full       121 GGTCGACTTTGGTTACGACATATCGGACTTCTACCAGATCCATCCCGAATATGGAACCAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8696R-3.in silico     121 GGTCGACTTTGGTTACGACATATCGGACTTCTACCAGATCCATCCCGAATATGGAACCAT 180


8696R-3.IR_full       181 GGAGGACTTTGAGCGAATGATCGCCAAGGCCAAGGAGGTGGGCATCAAGATCATCCTGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
8696R-3.in silico     181 GGAGGACTTTGAGCGAATGATCGCCAAGGCCAAGGAGGTGGGCATTAAAATCATCCTGGA 240


8696R-3.IR_full       241 CTTCGTACCAAACCACTCAAGTACCGAAAACGAATGGTTCACCAAGTCAGTGGACAGTGA 300
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
8696R-3.in silico     241 CTTCGTACCAAACCACTCAAGTACCGAAAACGAATGGTTCACCAAGTCTGTGGACAGTGA 300


8696R-3.IR_full       301 CCCCGTCTACAAAGACTTCTACATCTGGCACGATGGCAAGATCAACAACGAGACCGGTGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8696R-3.in silico     301 CCCCGTCTACAAAGACTTCTACATCTGGCACGATGGCAAGATCAACAACGAGACCGGTGA 360


8696R-3.IR_full       361 GCGGGAGCCGCCGAGCAACTGGAACTCTGAGTTTCGCTACAGCGCCTGGGAGTGGAACGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8696R-3.in silico     361 GCGGGAGCCGCCGAGCAACTGGAACTCTGAGTTTCGCTACAGCGCCTGGGAGTGGAACGA 420


8696R-3.IR_full       421 GGTGCGTCAGCAGTACTACCTCCACCAGTTCGCCATCCAGCAGGCCGACCTCAACTATCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8696R-3.in silico     421 GGTGCGTCAGCAGTACTACCTCCACCAGTTCGCCATCCAGCAGGCCGACCTCAACTATCG 480


8696R-3.IR_full       481 CAATCCGGCCGTGGTTAACGA 501
                          |||||||||||||||||||||
8696R-3.in silico     481 CAATCCGGCCGTGGTTAACGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057279.4  CG8696-RA (LvpH), mRNA 
5.8   28  27  34  32  NM_136540.1  CG8690-RA (CG8690), mRNA 
1.65   43  73  NM_136539.1  CG11669-RA (CG11669), mRNA 
1.03   11  20  45  NM_165608.1  CG30360-RA, transcript variant A (CG30360), mRNA 
1.03   11  20  45  NM_206057.1  CG30360-RB, transcript variant B (CG30360), mRNA 
0   NM_136409.1  CG17002-RB (CG17002), mRNA 
0   10  NM_057390.4  CG1391-RB, transcript variant B (sol), mRNA 
0   10  NM_206802.1  CG1391-RC, transcript variant C (sol), mRNA 
0   10  NM_057389.4  CG1391-RA, transcript variant A (sol), mRNA 
0   10  NM_206801.1  CG1391-RD, transcript variant D (sol), mRNA 
0   NM_080016.2  CG4481-RA (Glu-RIB), mRNA 
0   NM_164619.1  CG31650-RA, transcript variant A (CG31650), mRNA 
0   NM_164620.1  CG31650-RB, transcript variant B (CG31650), mRNA 
0   NM_135055.2  CG31650-RC, transcript variant C (CG31650), mRNA 
0   NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
0   NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
0   12  25  NM_057280.3  CG8695-RA (LvpL), mRNA 
0   NM_135169.2  CG9493-RA (Pez), mRNA 
0   NM_143201.3  CG14543-RA (CG14543), mRNA 
0   NM_139694.2  CG4603-RA (CG4603), mRNA 
0   NM_142621.3  CG5077-RA, transcript variant A (CG5077), mRNA 
0   NM_169892.2  CG5077-RB, transcript variant B (CG5077), mRNA 
0   NM_169893.2  CG5077-RC, transcript variant C (CG5077), mRNA 
0   NM_169894.2  CG5077-RD, transcript variant D (CG5077), mRNA 
0   NM_166120.1  CG30085-RA (CG30085), mRNA 
0   NM_057657.4  CG17158-RA (cpb), mRNA 
0   NM_138013.2  CG16787-RA (CG16787), mRNA 
0   NM_170189.1  CG31115-RA (CG31115), mRNA 
0   NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
0   NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.