National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8676R-2 
 Symbol Hr39  Full Name Hormone receptor-like in 39 
 CG No CG8676  Old CG No CG8676 
 Synonyms DHR39, CG8676, i70, EP(2)2490, DHR30, FTZ-F1B, DHR39/Ftz-F1beta, NR5B1, betaFTZ-F1, ftz-F1, unnamed, dFTZ-F1beta, ftz-F1beta, ftz-f1beta, FTZ-F1, FTZ-F1beta, Hr39 
 Accession No (Link to NCBI) NM_057584.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCCAGCATCAAAGCGGAG 
 Primer Seq. 3'
aatctagaggtaccATCGGTTGTAGTGCGCAGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCCAGCA TCAAAGCGCG AGCAGCAAAG CGGTCCTCTT GGAGGAAGTA GCGGCTATCA 
0061 AGTACCGGTC AACATGTGCA CCACCACAGT CGCGAATACG ACGACCACTT TGGGAAGCTC 
0121 CGCCGGGGGA GCCACTGGCT CCCGGCANCA ACGTCTCCGT GACAAACATC AAGTGCGAAC 
0181 TAGACGAACT ACCGTCACCG AACGGCAACA TGGTGCCGGT TATCGCAAAC TACGTTCACG 
0241 GGTAGCTTGC GCATTCCACT CAGTGGACAT TCAAATCATA GGGAGTCCGA TTCGGAGGAG 
0301 GAGCTGGCAA GTATTGAGAA CTTGAAGGTT CGGCGAAGGA CGGCGGCGGA CAAAAATGGT 
0361 CCTCGTCCAA TGTCCTGGGA GGGCGAGCTG AGCGATACTG AGGTCAACGG GGGCGAAGAG 
0421 CTGATGGAAA TGGAGCCAAC AATTAAGAGT GAGGTGGTCC CTGCTGTTGC ACCCCCACAA 
0481 CCCGTCTGCG CACTACAACC GAT 
 in silico PCR Fragment
0001 ATGTCCAGCA TCAAAGCG-G AGCAGCAAAG CGGTCCTCTT GGAGGAAGTA GCGGCTATCA 
0061 AGTACCGGTC AACATGTGCA CCACCACAGT CGCGAATACG ACGACCACTT TGGGAAGCTC 
0121 CGCCGGGGGA GCCACTGGCT CCCGGCA-CA ACGTCTCCGT GACAAACATC AAGTGCGAAC 
0181 TAGACGAACT ACCGTCACCG AACGGCAACA TGGTGCCGGT TATCGCAAAC TACGTTCAC- 
0241 GGTAGCTTGC GCATTCCACT CAGTGGACAT TCAAATCATA GGGAGTCCGA TTCGGAGGAG 
0301 GAGCTGGCAA GTATTGAGAA CTTGAAGGTT CGGCGAAGGA CGGCGGCGGA CAAAAATGGT 
0361 CCTCGTCCAA TGTCCTGGGA GGGCGAGCTG AGCGATACTG AGGTCAACGG GGGCGAAGAG 
0421 CTGATGGAAA TGGAGCCAAC AATTAAGAGT GAGGTGGTCC CTGCTGTTGC ACCCCCACAA 
0481 CCCGTCTGCG CACTACAACC GAT 
 Assemble Data

8676R-2.IR_full       1   ATGTCCAGCATCAAAGCGCGAGCAGCAAAGCGGTCCTCTTGGAGGAAGTAGCGGCTATCA 60
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
8676R-2.in silico     1   ATGTCCAGCATCAAAGCG-GAGCAGCAAAGCGGTCCTCTTGGAGGAAGTAGCGGCTATCA 60


8676R-2.IR_full       61  AGTACCGGTCAACATGTGCACCACCACAGTCGCGAATACGACGACCACTTTGGGAAGCTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8676R-2.in silico     61  AGTACCGGTCAACATGTGCACCACCACAGTCGCGAATACGACGACCACTTTGGGAAGCTC 120


8676R-2.IR_full       121 CGCCGGGGGAGCCACTGGCTCCCGGCANCAACGTCTCCGTGACAAACATCAAGTGCGAAC 180
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8676R-2.in silico     121 CGCCGGGGGAGCCACTGGCTCCCGGCA-CAACGTCTCCGTGACAAACATCAAGTGCGAAC 180


8676R-2.IR_full       181 TAGACGAACTACCGTCACCGAACGGCAACATGGTGCCGGTTATCGCAAACTACGTTCACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
8676R-2.in silico     181 TAGACGAACTACCGTCACCGAACGGCAACATGGTGCCGGTTATCGCAAACTACGTTCAC- 240


8676R-2.IR_full       241 GGTAGCTTGCGCATTCCACTCAGTGGACATTCAAATCATAGGGAGTCCGATTCGGAGGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8676R-2.in silico     241 GGTAGCTTGCGCATTCCACTCAGTGGACATTCAAATCATAGGGAGTCCGATTCGGAGGAG 300


8676R-2.IR_full       301 GAGCTGGCAAGTATTGAGAACTTGAAGGTTCGGCGAAGGACGGCGGCGGACAAAAATGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8676R-2.in silico     301 GAGCTGGCAAGTATTGAGAACTTGAAGGTTCGGCGAAGGACGGCGGCGGACAAAAATGGT 360


8676R-2.IR_full       361 CCTCGTCCAATGTCCTGGGAGGGCGAGCTGAGCGATACTGAGGTCAACGGGGGCGAAGAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8676R-2.in silico     361 CCTCGTCCAATGTCCTGGGAGGGCGAGCTGAGCGATACTGAGGTCAACGGGGGCGAAGAG 420


8676R-2.IR_full       421 CTGATGGAAATGGAGCCAACAATTAAGAGTGAGGTGGTCCCTGCTGTTGCACCCCCACAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8676R-2.in silico     421 CTGATGGAAATGGAGCCAACAATTAAGAGTGAGGTGGTCCCTGCTGTTGCACCCCCACAA 480


8676R-2.IR_full       481 CCCGTCTGCGCACTACAACCGAT 503
                          |||||||||||||||||||||||
8676R-2.in silico     481 CCCGTCTGCGCACTACAACCGAT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134296.2  CG8676-RB, transcript variant B (Hr39), mRNA 
100   482  NM_165364.1  CG8676-RD, transcript variant D (Hr39), mRNA 
100   482  NM_057584.4  CG8676-RA, transcript variant A (Hr39), mRNA 
100   482  NM_057585.2  CG8676-RC, transcript variant C (Hr39), mRNA 
0   NM_057958.3  CG3584-RA (qkr58E-3), mRNA 
0   NM_166110.1  CG30091-RA (CG30091), mRNA 
0   NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0   NM_134822.1  CG17237-RA (CG17237), mRNA 
0   NM_142377.1  CG18139-RA (CG18139), mRNA 
0   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   NM_167908.1  CG7961-RB, transcript variant B (alphaCop), mRNA 
0   NM_058047.3  CG7961-RA, transcript variant A (alphaCop), mRNA 
0   NM_058041.2  CG12467-RA (CG12467), mRNA 
0   NM_138216.1  CG13886-RA (CG13886), mRNA 
0   NM_165584.1  CG18455-RB, transcript variant B (Optix), mRNA 
0   NM_079956.2  CG18455-RA, transcript variant A (Optix), mRNA 
0   NM_131991.2  CG3252-RA (CG3252), mRNA 
0   NM_167192.1  CG32700-RB, transcript variant B (CG32700), mRNA 
0   NM_167191.1  CG32700-RA, transcript variant A (CG32700), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   13  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   13  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   13  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_078713.2  CG17596-RA (S6kII), mRNA 
0   NM_078705.2  CG1685-RA (pen), mRNA 
0   NM_142739.2  CG6678-RA (CG6678), mRNA 
0   NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.