National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8638R-3 
 Symbol Cpr65Eb  Full Name Cuticular protein 65Eb 
 CG No CG8638  Old CG No CG8638 
 Synonyms BcDNA:RE28679, Cpr65Eb, CG8638 
 Accession No (Link to NCBI) NM_139819.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATGCCGAGATCCGGAGCTTT 
 Primer Seq. 3'
aatctagaggtaccCTGTCGTAGGGCAGGACCTGA 
 Predicted Fragment Size
446 
 IR fragment full Seq
0001 CATGCCGAGA TCCGGAGCTT TGTCAACGAG CTGAAGCAGG AGGATGGCAT CTACAATTAC 
0061 CAGTTCGAGA CGTCCAACGG GATTGCGCAG CAGGAGCAGG GAGTGGGTGG TTACTACGCT 
0121 AGCGGCTCAT CACAGTACTA CACACCCGAG GGCCAGCTCA TCCAGTTGAC CTACACGGCA 
0181 GATGAGAACG GATTCCAGCC GCAGGGCGAG CACCTGCCCA CGCCCCATCC CATTCCCGAG 
0241 GCAATCCTGA AGTCGCTGGA GTACAATCGC AACCACCCGG AGGAGGATGG GGAGTACGAG 
0301 CACCACGACC ATCACCATGA CCACCATGAG CATCACCAGA GCCATGGTCA GGAGCAGGGC 
0361 AAGCAATATC TGCAGCCAGC CGGTGCTCTG CTCGCACCTG CGTCATCGCC AGTGTTGTCT 
0421 GTGGGTCAGG TCCTGCCNTA CGACAG 
 in silico PCR Fragment
0001 CATGCCGAGA TCCGGAGCTT TGTCAACGAA CTGAAGCAGG AGGATGGCAT CTACAATTAC 
0061 CAGTTCGAGA CGTCCAACGG GATTGCGCAG CAGGAGCAGG GAGTGGGTGG TTACTACGCT 
0121 AGCGGCTCAT CACAGTACTA CACACCCGAG GGCCAGCTCA TCCAGTTGAC CTACACGGCA 
0181 GATGAGAACG GATTCCAGCC GCAGGGCGAG CACCTGCCCA CGCCCCATCC CATTCCCGAG 
0241 GCAATCCTGA AGTCGCTGGA GTACAATCGC AACCACCCGG AGGAGGATGG GGAGTACGAG 
0301 CACCACGACC ATCACCATGA CCACCATGAG CATCACCAGA GCCATGGTCA GGAGCAGGGC 
0361 AAGCAGTATC TGCAGCCAGC CGGTGCTCTG CTCGCACCTG CGTCATCGCC AGTGTTGTCT 
0421 GTGGGTCAGG TCCTGCCCTA CGACAG 
 Assemble Data

8638R-3.IR_full       1   CATGCCGAGATCCGGAGCTTTGTCAACGAGCTGAAGCAGGAGGATGGCATCTACAATTAC 60
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
8638R-3.in silico     1   CATGCCGAGATCCGGAGCTTTGTCAACGAACTGAAGCAGGAGGATGGCATCTACAATTAC 60


8638R-3.IR_full       61  CAGTTCGAGACGTCCAACGGGATTGCGCAGCAGGAGCAGGGAGTGGGTGGTTACTACGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8638R-3.in silico     61  CAGTTCGAGACGTCCAACGGGATTGCGCAGCAGGAGCAGGGAGTGGGTGGTTACTACGCT 120


8638R-3.IR_full       121 AGCGGCTCATCACAGTACTACACACCCGAGGGCCAGCTCATCCAGTTGACCTACACGGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8638R-3.in silico     121 AGCGGCTCATCACAGTACTACACACCCGAGGGCCAGCTCATCCAGTTGACCTACACGGCA 180


8638R-3.IR_full       181 GATGAGAACGGATTCCAGCCGCAGGGCGAGCACCTGCCCACGCCCCATCCCATTCCCGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8638R-3.in silico     181 GATGAGAACGGATTCCAGCCGCAGGGCGAGCACCTGCCCACGCCCCATCCCATTCCCGAG 240


8638R-3.IR_full       241 GCAATCCTGAAGTCGCTGGAGTACAATCGCAACCACCCGGAGGAGGATGGGGAGTACGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8638R-3.in silico     241 GCAATCCTGAAGTCGCTGGAGTACAATCGCAACCACCCGGAGGAGGATGGGGAGTACGAG 300


8638R-3.IR_full       301 CACCACGACCATCACCATGACCACCATGAGCATCACCAGAGCCATGGTCAGGAGCAGGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8638R-3.in silico     301 CACCACGACCATCACCATGACCACCATGAGCATCACCAGAGCCATGGTCAGGAGCAGGGC 360


8638R-3.IR_full       361 AAGCAATATCTGCAGCCAGCCGGTGCTCTGCTCGCACCTGCGTCATCGCCAGTGTTGTCT 420
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8638R-3.in silico     361 AAGCAGTATCTGCAGCCAGCCGGTGCTCTGCTCGCACCTGCGTCATCGCCAGTGTTGTCT 420


8638R-3.IR_full       421 GTGGGTCAGGTCCTGCCNTACGACAG 446
                          ||||||||||||||||| ||||||||
8638R-3.in silico     421 GTGGGTCAGGTCCTGCCCTACGACAG 446

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   428  NM_139819.2  CG8638-RA (CG8638), mRNA 
1.86   13  20  26  NM_139820.1  CG8634-RA (CG8634), mRNA 
1.4   13  NM_130551.1  CG14770-RA (CG14770), mRNA 
1.16   15  NM_139774.1  CG12330-RA (CG12330), mRNA 
0.7   NM_136932.1  CG8511-RA (CG8511), mRNA 
0.46   10  NM_144403.1  CG18777-RA (CG18777), mRNA 
0.46   NM_176290.1  CG10529-RA (Lcp65Ae), mRNA 
0.46   NM_165194.2  CG31991-RB, transcript variant B (mdy), mRNA 
0.46   NM_206002.1  CG31991-RD, transcript variant D (mdy), mRNA 
0.46   NM_001042896.1  CG16863-RB, transcript variant B (CG16863), mRNA 
0.46   NM_135830.3  CG16863-RA, transcript variant A (CG16863), mRNA 
0.46   12  NM_142397.1  CG14318-RA (CG14318), mRNA 
0.46   NM_165195.2  CG31991-RC, transcript variant C (mdy), mRNA 
0.46   NM_135969.3  CG31991-RA, transcript variant A (mdy), mRNA 
0.23   NM_142113.1  CG14854-RA (CG14854), mRNA 
0   16  10  NM_165891.1  CG30045-RA (CG30045), mRNA 
0   13  11  NM_136930.3  CG8505-RA (CG8505), mRNA 
0   NM_057924.2  CG10534-RA (Lcp65Ag2), mRNA 
0   NM_057925.2  CG10530-RA (Lcp65Ag1), mRNA 
0   12  NM_057932.1  CG7287-RA (Lcp65Aa), mRNA 
0   NR_001423.1  CG7287-RA (Lcp65Aa), mRNA, mRNA 
0   13  20  NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
0   NM_140783.2  CG7285-RA (star1), mRNA 
0   NM_143372.1  CG9995-RA (htt), mRNA 
0   NM_078632.2  CG17336-RB, transcript variant B (Lcch3), mRNA 
0   NM_206746.1  CG17336-RC, transcript variant C (Lcch3), mRNA 
0   NM_167475.1  CG17336-RA, transcript variant A (Lcch3), mRNA 
0   14  13  NM_168158.1  CG32405-RA (CG32405), mRNA 
0   12  NM_176291.1  CG18773-RA (Lcp65Ab2), mRNA 
0   12  NM_080075.2  CG32400-RA (Lcp65Ab1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.