National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8634R-2 
 Symbol Cpr65Ec  Full Name Cuticular protein 65Ec 
 CG No CG8634  Old CG No CG8634 
 Synonyms Cpr65Ec, CG8634 
 Accession No (Link to NCBI) NM_139820.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAATTCTTCGTCCTTGCCGT 
 Primer Seq. 3'
aatctagaggtaccCTAGAATCGTCCTTGACCCTG 
 Predicted Fragment Size
379 
 IR fragment full Seq
0001 CAAATTCTTC GTNCCTTGCC GTCGCCGCCT TGGCTGTTTC CTGTGTCCAG GCCGACTCCT 
0061 TCGACGCCCG AGCCGAGACT CGCGAGTATA AGAGCGACCT GAAGGAGGAT GGCAGCTATG 
0121 CCTATCAGTA CCAGACGTCC AATGGCATCG CTGGCCAGGA ATCGGGCGTG GGTGGTTACT 
0181 ATGCCAGCGg CTCGAACGCC TACTACGCCC CCGATGGCCA GCTCATCCAG TTGACCTACA 
0241 CCGCCGACAG CAATGGCTAC CACCCGGCCG GCGCCCATCT GCCCACACCT CCTCCAATCC 
0301 CGGCTGCCAT CCTGAAGTCA CTGGAGTACA TCCGCACCCA TCCCCAGCAG GAGAGTCGCC 
0361 AGGGTCAAGG ACGATTCTAG  
 in silico PCR Fragment
0001 CAAATTCTTC GT-CCTTGCC GTCGCCGCCC TGGCTGTTTC CTGTGTCCAG GCCGACTCCT 
0061 TCGACGCCCG AGCCGAGACT CGCGAGTATA AGAGCGACCT GAAGGAGGAT GGCAGCTATG 
0121 CCTATCAGTA CCAGACGTCC AATGGCATCG CTGGCCAGGA ATCGGGCGTG GGTGGTTACT 
0181 ATGCCAGCGG CTCGAACGCC TACTACGCCC CCGATGGCCA GCTCATCCAG TTGACCTACA 
0241 CCGCCGACAG CAATGGCTAC CACCCGGCCG GCGCCCATCT GCCCACACCT CCTCCAATCC 
0301 CGGCTTCCAT CCTGAAGTCA CTGGAGTACA TCCGCACCCA TCCCCAGCAG GAGAGTCGCC 
0361 AGGGTCAAGG ACGATTCTAG  
 Assemble Data

8634R-2.IR_full       1   CAAATTCTTCGTNCCTTGCCGTCGCCGCCTTGGCTGTTTCCTGTGTCCAGGCCGACTCCT 60
                          |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||
8634R-2.in silico     1   CAAATTCTTCGT-CCTTGCCGTCGCCGCCCTGGCTGTTTCCTGTGTCCAGGCCGACTCCT 60


8634R-2.IR_full       61  TCGACGCCCGAGCCGAGACTCGCGAGTATAAGAGCGACCTGAAGGAGGATGGCAGCTATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8634R-2.in silico     61  TCGACGCCCGAGCCGAGACTCGCGAGTATAAGAGCGACCTGAAGGAGGATGGCAGCTATG 120


8634R-2.IR_full       121 CCTATCAGTACCAGACGTCCAATGGCATCGCTGGCCAGGAATCGGGCGTGGGTGGTTACT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8634R-2.in silico     121 CCTATCAGTACCAGACGTCCAATGGCATCGCTGGCCAGGAATCGGGCGTGGGTGGTTACT 180


8634R-2.IR_full       181 ATGCCAGCGGCTCGAACGCCTACTACGCCCCCGATGGCCAGCTCATCCAGTTGACCTACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8634R-2.in silico     181 ATGCCAGCGGCTCGAACGCCTACTACGCCCCCGATGGCCAGCTCATCCAGTTGACCTACA 240


8634R-2.IR_full       241 CCGCCGACAGCAATGGCTACCACCCGGCCGGCGCCCATCTGCCCACACCTCCTCCAATCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8634R-2.in silico     241 CCGCCGACAGCAATGGCTACCACCCGGCCGGCGCCCATCTGCCCACACCTCCTCCAATCC 300


8634R-2.IR_full       301 CGGCTGCCATCCTGAAGTCACTGGAGTACATCCGCACCCATCCCCAGCAGGAGAGTCGCC 360
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8634R-2.in silico     301 CGGCTTCCATCCTGAAGTCACTGGAGTACATCCGCACCCATCCCCAGCAGGAGAGTCGCC 360


8634R-2.IR_full       361 AGGGTCAAGGACGATTCTAG 380
                          ||||||||||||||||||||
8634R-2.in silico     361 AGGGTCAAGGACGATTCTAG 380

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   361  NM_139820.1  CG8634-RA (CG8634), mRNA 
2.21   13  20  26  NM_139819.2  CG8638-RA (CG8638), mRNA 
1.93   16  13  NM_140161.1  CG7941-RA (CG7941), mRNA 
0   10  21  NM_140162.1  CG18349-RA (CG18349), mRNA 
0   NM_057274.3  CG2044-RA (Lcp4), mRNA 
0   NM_141041.1  CG11310-RA (CG11310), mRNA 
0   NM_057271.2  CG11650-RA (Lcp1), mRNA 
0   NM_057272.3  CG8697-RA (Lcp2), mRNA 
0   NM_135082.2  CG6604-RA (H15), mRNA 
0   10  NM_079474.3  CG7673-RA (Edg78E), mRNA 
0   NM_137498.1  CG15069-RA, transcript variant A (Rgk2), mRNA 
0   NM_142954.3  CG6057-RA (SMC1), mRNA 
0   NM_143048.1  CG11089-RA (CG11089), mRNA 
0   NM_143467.2  CG7615-RA (fig), mRNA 
0   NM_135767.1  CG5682-RA (CG5682), mRNA 
0   NM_057841.3  CG5102-RA (da), mRNA 
0   NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0   NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   NM_133020.2  CG6506-RA (CG6506), mRNA 
0   NM_079086.2  CG5821-RA (qkr58E-2), mRNA 
0   NM_136097.2  CG17572-RA (CG17572), mRNA 
0   NM_135918.2  CG4587-RA (CG4587), mRNA 
0   NM_141633.1  CG8135-RA (CG8135), mRNA 
0   19  NM_057273.3  CG2043-RA (Lcp3), mRNA 
0   17  NM_136931.1  CG8510-RA (CG8510), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_176036.1  CG32973-RA (CG32973), mRNA 
0   NM_205956.1  CG33302-RA (CG33302), mRNA 
0   10  NM_139617.1  CG15008-RA (CG15008), mRNA 
0   10  NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.