National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8632R-1 
 Symbol CG8632  Full Name CG8632 
 CG No CG8632  Old CG No CG8632 
 Synonyms CG8632 
 Accession No (Link to NCBI) NM_136962.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat. Cell Biol. (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGAAGACACCAGCACTTGGG 
 Primer Seq. 3'
aatctagaggtaccGCACAGCACCAGACGGAGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGAAGACAC CAGCACTTGG GAAAGGCTTT TAGCCAGTGC TCCTTACGTC AAGACGGCAG 
0061 GAACCCTTGG AGGCGGCATG ACGGCGAGGC ATTCAAACTA CAGCCGTGGA AGCGACCAAG 
0121 CACGTTCCTT CAGTTTCGCT GCAGCgCCAA TGGCAGTGAT TCCAAGAAGG AAAAACCTGT 
0181 GCAGGAGGAG GCCACCGCTG GTCCAGTTGC CAAGCCAAAG GAAACGAAAA ACTTTGAGGT 
0241 GAAGACCACA AAGGGCATCC TGTCTATCAG CACCACCATC GAGGACTCCA AAATTAACGA 
0301 GATTGTGTTT GAAAAATCCG ATCTGCCACC GGTAACGAAG GTGAAAGAGC CGGTTTTGGC 
0361 CGCAAGTGCC ATTAATCTAC GTTCTACGTC TACTGGAGTA GCAACTGGTG CTGTAGGATT 
0421 GGGAGAGAGC TCTGGTTCTG TTATGAATCC TCCTGAAACA GTGAAAAGCG CACCTAAAAA 
0481 TTCTCCGTCT GGTGCTGTGC  
 in silico PCR Fragment
0001 GCGAAGACAC CAGCACTTGG GAAAGGCTTT TAGCCAGTGC TCCTTACGTC AAGACGGCAG 
0061 GAACCCTTGG AGGCGGCATG ACGGCGAGGC ATTCAAACTA CAGCCGTGGA AGCGACCAAG 
0121 CACGTTCCTT CAGTTTCGCT GCAGCGCCAA TGGCAGTGAT TCCAAGAAGG AAAAACCTGT 
0181 GCAGGAGGAG GCCACCGCTG GTCCAGTTGC CAAGCCAAAG GAAACGAAAA ACTTTGAGGT 
0241 GAAGACCACA AAGGGCATCC TGTCTATCAG CACCACCATC GAGGACTCCA AAATTAACGA 
0301 GATTGTGTTT GAAAAATCCG ATCTGCCACC GGTAACGAAG GTGAAAGAGC CGGTTTTGGC 
0361 CGCAAGTGCC ATTAATCTAC GTTCTACGTC TACTGGAGTA GCAACTGGTG CTGTAGGATT 
0421 GGGAGAGAGC TCTGGTTCTG TTATGAATCC TCCTGAAACA GTGAAAAGCG CACCTAAAAA 
0481 TTCTCCGTCT GGTGCTGTGC  
 Assemble Data

8632R-1.IR_full       1   GCGAAGACACCAGCACTTGGGAAAGGCTTTTAGCCAGTGCTCCTTACGTCAAGACGGCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     1   GCGAAGACACCAGCACTTGGGAAAGGCTTTTAGCCAGTGCTCCTTACGTCAAGACGGCAG 60


8632R-1.IR_full       61  GAACCCTTGGAGGCGGCATGACGGCGAGGCATTCAAACTACAGCCGTGGAAGCGACCAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     61  GAACCCTTGGAGGCGGCATGACGGCGAGGCATTCAAACTACAGCCGTGGAAGCGACCAAG 120


8632R-1.IR_full       121 CACGTTCCTTCAGTTTCGCTGCAGCGCCAATGGCAGTGATTCCAAGAAGGAAAAACCTGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     121 CACGTTCCTTCAGTTTCGCTGCAGCGCCAATGGCAGTGATTCCAAGAAGGAAAAACCTGT 180


8632R-1.IR_full       181 GCAGGAGGAGGCCACCGCTGGTCCAGTTGCCAAGCCAAAGGAAACGAAAAACTTTGAGGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     181 GCAGGAGGAGGCCACCGCTGGTCCAGTTGCCAAGCCAAAGGAAACGAAAAACTTTGAGGT 240


8632R-1.IR_full       241 GAAGACCACAAAGGGCATCCTGTCTATCAGCACCACCATCGAGGACTCCAAAATTAACGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     241 GAAGACCACAAAGGGCATCCTGTCTATCAGCACCACCATCGAGGACTCCAAAATTAACGA 300


8632R-1.IR_full       301 GATTGTGTTTGAAAAATCCGATCTGCCACCGGTAACGAAGGTGAAAGAGCCGGTTTTGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     301 GATTGTGTTTGAAAAATCCGATCTGCCACCGGTAACGAAGGTGAAAGAGCCGGTTTTGGC 360


8632R-1.IR_full       361 CGCAAGTGCCATTAATCTACGTTCTACGTCTACTGGAGTAGCAACTGGTGCTGTAGGATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     361 CGCAAGTGCCATTAATCTACGTTCTACGTCTACTGGAGTAGCAACTGGTGCTGTAGGATT 420


8632R-1.IR_full       421 GGGAGAGAGCTCTGGTTCTGTTATGAATCCTCCTGAAACAGTGAAAAGCGCACCTAAAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8632R-1.in silico     421 GGGAGAGAGCTCTGGTTCTGTTATGAATCCTCCTGAAACAGTGAAAAGCGCACCTAAAAA 480


8632R-1.IR_full       481 TTCTCCGTCTGGTGCTGTGC 500
                          ||||||||||||||||||||
8632R-1.in silico     481 TTCTCCGTCTGGTGCTGTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136962.2  CG8632-RA, transcript variant A (CG8632), mRNA 
100   482  NM_165933.1  CG8632-RB, transcript variant B (CG8632), mRNA 
0   NM_132903.1  CG9906-RA (CG9906), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_166072.1  CG10205-RA, transcript variant A (CG10205), mRNA 
0   NM_167062.1  CG3774-RB, transcript variant B (CG3774), mRNA 
0   NM_132071.1  CG3774-RA, transcript variant A (CG3774), mRNA 
0   NM_165399.1  CG1416-RC, transcript variant C (CG1416), mRNA 
0   NM_136277.2  CG1416-RA, transcript variant A (CG1416), mRNA 
0   NM_165398.1  CG1416-RB, transcript variant B (CG1416), mRNA 
0   NM_166436.1  CG30390-RA (CG30390), mRNA 
0   NM_132305.1  CG12115-RA (CG12115), mRNA 
0   NM_164564.1  CG31957-RA (CG31957), mRNA 
0   NM_143225.2  CG6490-RA (CG6490), mRNA 
0   NM_169419.1  CG18476-RA (CG18476), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
0   NM_168143.1  CG32408-RA (CG32408), mRNA 
0   NM_140095.2  CG18176-RA (defl), mRNA 
0   NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_132525.1  CG15740-RA (CG15740), mRNA 
0   NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
0   NM_166958.1  CG3653-RA, transcript variant A (kirre), mRNA 
0   NM_079810.4  CG12878-RA, transcript variant A (btz), mRNA 
0   NM_170350.1  CG12878-RB, transcript variant B (btz), mRNA 
0   NM_132778.1  CG9095-RA (CG9095), mRNA 
0   11  NM_134904.2  CG3523-RA (CG3523), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.