National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8625R-2 
 Symbol Iswi  Full Name Imitation SWI 
 CG No CG8625  Old CG No CG8625 
 Synonyms NURF, ISWI, CG8625, ACF, iswi, p140/ISWI, p140, dNURF, CHRAC, dISWI, dCHRAC, SWI, ISW, NURF-140, anon-EP1279744.124, Nurf-140, Iswi 
 Accession No (Link to NCBI) NM_078995.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACAGCTGCCGTGGAGGCAAC 
 Primer Seq. 3'
aatctagaggtaccGCTTGAGGTAACCCAGCAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACAGCTGcC GTGGAGGCAA CCGAAGAGAA CTCGAACGAG ACGACTTCAG ATGCGGCCAC 
0061 CAGTTCATCC GGTGAAAAGG AGGCTGAGTT CGACAACAAA ATCGAGGCTG ATCGCAGTAG 
0121 GcGCTTTGAT TTCCTGCTAA AGCAGACGGA GATATTCACC CACTTCATGA CTAACAGCGC 
0181 TAAGAGTCCC ACGAAGCCTA AGGGTAGACC CAAGAAGATC AAAGACAAGG ACAAGGAAAA 
0241 GGATGTGGCC GATCATCGTC ATCGCAAGAC AGAGCAGTGA GGAGGATGAG GAGTTGCTGG 
0301 CGGAAGACTC GGCCACCAAG GAGATCTTTC GCTTCGATGC CTCACCCGCC TACATCAAAA 
0361 GTGGAGAGAT GCGTGACTAC CAGATTCGCG GTCTTAACTG GATGATTTCG CTTTACGAAA 
0421 ATGGTATCAA TGGAATTCTG GCCGATGAAA TGGGTCTAGG AAAGACCCTG CAGACCATAT 
0481 CTCTGCTGGG TTACCTCAAG C 
 in silico PCR Fragment
0001 TACAGCTGCC GTGGAGGCAA CCGAAGAGAA CTCGAACGAG ACGACTTCAG ATGCGGCCAC 
0061 CAGTTCATCC GGTGAAAAGG AGGCTGAGTT CGACAACAAA ATCGAGGCTG ATCGCAGTAG 
0121 GCGCTTTGAT TTCCTGCTAA AGCAGACGGA GATATTCACC CACTTCATGA CTAACAGCGC 
0181 TAAGAGTCCC ACGAAGCCTA AGGGTAGACC CAAGAAGATC AAAGACAAGG ACAAGGAAAA 
0241 GGATGTGGCC GATCATCGTC ATCGCAAGAC AGAGCAG-GA GGAGGATGAG GAGTTGCTGG 
0301 CGGAAGACTC GGCCACCAAG GAGATCTTTC GCTTCGATGC CTCACCCGCC TACATCAAAA 
0361 GTGGAGAGAT GCGTGACTAC CAGATTCGCG GTCTTAACTG GATGATTTCG CTTTACGAAA 
0421 ATGGTATCAA TGGAATTCTG GCCGATGAAA TGGGTCTAGG AAAGACCCTG CAGACCATAT 
0481 CTCTGCTGGG TTACCTCAAG C 
 Assemble Data

8625R-2.IR_full       1   TACAGCTGCCGTGGAGGCAACCGAAGAGAACTCGAACGAGACGACTTCAGATGCGGCCAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     1   TACAGCTGCCGTGGAGGCAACCGAAGAGAACTCGAACGAGACGACTTCAGATGCGGCCAC 60


8625R-2.IR_full       61  CAGTTCATCCGGTGAAAAGGAGGCTGAGTTCGACAACAAAATCGAGGCTGATCGCAGTAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     61  CAGTTCATCCGGTGAAAAGGAGGCTGAGTTCGACAACAAAATCGAGGCTGATCGCAGTAG 120


8625R-2.IR_full       121 GCGCTTTGATTTCCTGCTAAAGCAGACGGAGATATTCACCCACTTCATGACTAACAGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     121 GCGCTTTGATTTCCTGCTAAAGCAGACGGAGATATTCACCCACTTCATGACTAACAGCGC 180


8625R-2.IR_full       181 TAAGAGTCCCACGAAGCCTAAGGGTAGACCCAAGAAGATCAAAGACAAGGACAAGGAAAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     181 TAAGAGTCCCACGAAGCCTAAGGGTAGACCCAAGAAGATCAAAGACAAGGACAAGGAAAA 240


8625R-2.IR_full       241 GGATGTGGCCGATCATCGTCATCGCAAGACAGAGCAGTGAGGAGGATGAGGAGTTGCTGG 300
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
8625R-2.in silico     241 GGATGTGGCCGATCATCGTCATCGCAAGACAGAGCAG-GAGGAGGATGAGGAGTTGCTGG 300


8625R-2.IR_full       301 CGGAAGACTCGGCCACCAAGGAGATCTTTCGCTTCGATGCCTCACCCGCCTACATCAAAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     301 CGGAAGACTCGGCCACCAAGGAGATCTTTCGCTTCGATGCCTCACCCGCCTACATCAAAA 360


8625R-2.IR_full       361 GTGGAGAGATGCGTGACTACCAGATTCGCGGTCTTAACTGGATGATTTCGCTTTACGAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     361 GTGGAGAGATGCGTGACTACCAGATTCGCGGTCTTAACTGGATGATTTCGCTTTACGAAA 420


8625R-2.IR_full       421 ATGGTATCAATGGAATTCTGGCCGATGAAATGGGTCTAGGAAAGACCCTGCAGACCATAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8625R-2.in silico     421 ATGGTATCAATGGAATTCTGGCCGATGAAATGGGTCTAGGAAAGACCCTGCAGACCATAT 480


8625R-2.IR_full       481 CTCTGCTGGGTTACCTCAAGC 501
                          |||||||||||||||||||||
8625R-2.in silico     481 CTCTGCTGGGTTACCTCAAGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078995.1  CG8625-RA, transcript variant A (Iswi), mRNA 
100   482  NM_165930.1  CG8625-RB, transcript variant B (Iswi), mRNA 
100   482  NM_165931.1  CG8625-RC, transcript variant C (Iswi), mRNA 
0.2   NM_166109.1  CG8205-RB, transcript variant B (fus), mRNA 
0.2   NM_166107.1  CG8205-RE, transcript variant E (fus), mRNA 
0.2   NM_166108.1  CG8205-RF, transcript variant F (fus), mRNA 
0.2   NM_079952.2  CG8205-RD, transcript variant D (fus), mRNA 
0   14  32  45  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   15  NM_079522.2  CG10281-RA (TfIIFalpha), mRNA 
0   24  NM_136942.2  CG8545-RA (CG8545), mRNA 
0   10  25  NM_143377.2  CG1646-RA, transcript variant A (CG1646), mRNA 
0   10  25  NM_176576.1  CG1646-RC, transcript variant C (CG1646), mRNA 
0   10  25  NM_176577.1  CG1646-RD, transcript variant D (CG1646), mRNA 
0   10  25  NM_170377.1  CG1646-RB, transcript variant B (CG1646), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   17  15  NM_168387.1  CG6711-RA (Taf2), mRNA 
0   11  15  NM_168640.1  CG5942-RD, transcript variant D (brm), mRNA 
0   11  15  NM_080497.4  CG5942-RC, transcript variant C (brm), mRNA 
0   11  15  NM_168641.1  CG5942-RB, transcript variant B (brm), mRNA 
0   11  15  NM_080498.2  CG5942-RA, transcript variant A (brm), mRNA 
0   13  31  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   32  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   32  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   28  NM_167620.2  CG32547-RA (CG32547), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.