National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8577R-1 
 Symbol PGRP-SC1b  Full Name PGRP-SC1b 
 CG No CG8577  Old CG No CG8577 
 Synonyms CT8705, PGRP-SC1B, PGRP-SC, CG8577, SC1B, PGRP-SC1b 
 Accession No (Link to NCBI) NM_136565.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGCGTCTATGTCGTCTCCAA 
 Primer Seq. 3'
aatctagaggtaccTAACCAGACCAGTGGGACCAG 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 GGGCGTCTAT GTCGTCTCTC AAGGCGGAGT GGGGTGGTCG CGGCGCCAAA TGGACCGTAG 
0061 GCCTGGGCAA CTACCTNCAG CTACGCCATC ATCCACCACA CCGCCGGCTC CTACTGCGAG 
0121 ACCCGTGCCC AGTGCAACGC CGTGCNTGCA GAGCGTCCAG AACTACCACA TGGACTCCCT 
0181 GGGCTGGCCC GACATCGGCT ACAACTTCCT GATCGGCGGA GACGGCAACG TGTACGAGGG 
0241 GCGTGGCTGG AACAAACATG GGCGCCCACG CCGCCGAGTG GAACCCCTAC AGCATCGGCA 
0301 TCAGCTTCCT GGGCAACTAC AACTGGGACA CCCTGGAGCC GAACATGATC TCCGCCGCCC 
0361 AGCAGCTGCT CAACGACGCC GTCAACCGTG GCCAGCTCAG CTCCGGCTAC ATCTGACGTA 
0421 TGCTGTACGG TCGATGCCGC CAGGTCAGCG CCACCGAATG cCCCGGCACT CACATCTGGA 
0481 ATCGAGACTT CCGCGGCTGG TCCCACTGGT CTGGTTA 
 in silico PCR Fragment
0001 GGGCGTCTAT GTCGTCTC-C AAGGCGGAGT GGGGTGGTCG CGGCGCCAAA TGGACCGTAG 
0061 GCCTGGGCAA CTACCT-CAG CTACGCCATC ATCCACCACA CCGCCGGCTC CTACTGCGAG 
0121 ACCCGTGCCC AGTGCAACGC CGTGC-TGCA GAGCGTCCAG AACTACCACA TGGACTCCCT 
0181 GGGCTGGCCC GACATCGGCT ACAACTTCCT GATCGGCGGA GACGGCAACG TGTACGAGGG 
0241 GCGTGGCTGG AAC-AACATG GGCGCCCACG CCGCCGAGTG GAACCCCTAC AGCATCGGCA 
0301 TCAGCTTCCT GGGCAACTAC AACTGGGACA CCCTGGAGCC GAACATGATC TCCGCCGCCC 
0361 AGCAGCTGCT CAACGACGCC GTCAACCGTG GCCAGCTCAG CTCCGGCTAC ATC------- 
0421 --CTGTACGG TC-AT--CGC CAGGTCAGCG CCACCGAATG CCCCGGCACT CACATCTGGA 
0481 A-CGAGA--T CCGCGGCTGG TCCCACTGGT CTGGTTA 
 Assemble Data

8577R-1.IR_full       1   GGGCGTCTATGTCGTCTCTCAAGGCGGAGTGGGGTGGTCGCGGCGCCAAATGGACCGTAG 60
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
8577R-1.in silico     1   GGGCGTCTATGTCGTCTC-CAAGGCGGAGTGGGGTGGTCGCGGCGCCAAATGGACCGTAG 60


8577R-1.IR_full       61  GCCTGGGCAACTACCTNCAGCTACGCCATCATCCACCACACCGCCGGCTCCTACTGCGAG 120
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
8577R-1.in silico     61  GCCTGGGCAACTACCT-CAGCTACGCCATCATCCACCACACCGCCGGCTCCTACTGCGAG 120


8577R-1.IR_full       121 ACCCGTGCCCAGTGCAACGCCGTGCNTGCAGAGCGTCCAGAACTACCACATGGACTCCCT 180
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
8577R-1.in silico     121 ACCCGTGCCCAGTGCAACGCCGTGC-TGCAGAGCGTCCAGAACTACCACATGGACTCCCT 180


8577R-1.IR_full       181 GGGCTGGCCCGACATCGGCTACAACTTCCTGATCGGCGGAGACGGCAACGTGTACGAGGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8577R-1.in silico     181 GGGCTGGCCCGACATCGGCTACAACTTCCTGATCGGCGGAGACGGCAACGTGTACGAGGG 240


8577R-1.IR_full       241 GCGTGGCTGGAACAAACATGGGCGCCCACGCCGCCGAGTGGAACCCCTACAGCATCGGCA 300
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
8577R-1.in silico     241 GCGTGGCTGGAAC-AACATGGGCGCCCACGCCGCCGAGTGGAACCCCTACAGCATCGGCA 300


8577R-1.IR_full       301 TCAGCTTCCTGGGCAACTACAACTGGGACACCCTGGAGCCGAACATGATCTCCGCCGCCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8577R-1.in silico     301 TCAGCTTCCTGGGCAACTACAACTGGGACACCCTGGAGCCGAACATGATCTCCGCCGCCC 360


8577R-1.IR_full       361 AGCAGCTGCTCAACGACGCCGTCAACCGTGGCCAGCTCAGCTCCGGCTACATCTGACGTA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||       
8577R-1.in silico     361 AGCAGCTGCTCAACGACGCCGTCAACCGTGGCCAGCTCAGCTCCGGCTACATC------- 420


8577R-1.IR_full       421 TGCTGTACGGTCGATGCCGCCAGGTCAGCGCCACCGAATGCCCCGGCACTCACATCTGGA 480
                            |||||||||| ||  |||||||||||||||||||||||||||||||||||||||||||
8577R-1.in silico     421 --CTGTACGGTC-AT--CGCCAGGTCAGCGCCACCGAATGCCCCGGCACTCACATCTGGA 480


8577R-1.IR_full       481 ATCGAGACTTCCGCGGCTGGTCCCACTGGTCTGGTTA 517
                          | |||||  ||||||||||||||||||||||||||||
8577R-1.in silico     481 A-CGAGA--TCCGCGGCTGGTCCCACTGGTCTGGTTA 517

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_136565.1  CG8577-RA (PGRP-SC1b), mRNA 
95.41   458  22  NM_136563.1  CG14746-RA (PGRP-SC1a), mRNA 
7.91   38  25  99  49  NM_136566.1  CG14745-RA (PGRP-SC2), mRNA 
0.62   12  NM_206308.2  CG4432-RC, transcript variant C (PGRP-LC), mRNA 
0.62   NM_168324.2  CG4432-RA, transcript variant A (PGRP-LC), mRNA 
0.2   NM_168037.1  CG32264-RA, transcript variant A (CG32264), mRNA 
0.2   NM_206268.1  CG32264-RC, transcript variant C (CG32264), mRNA 
0.2   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_138073.1  CG13579-RA (CG13579), mRNA 
0   NM_132499.2  CG11709-RA (PGRP-SA), mRNA 
0   NM_137120.1  CG17386-RA (CG17386), mRNA 
0   NM_166554.1  CG3612-RA (blw), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_167259.1  CG1615-RA, transcript variant A (Ork1), mRNA 
0   NM_078557.4  CG1615-RB, transcript variant B (Ork1), mRNA 
0   NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_136683.2  CG1516-RE, transcript variant E (CG1516), mRNA 
0   NM_001043138.1  CG17672-RA (CG17672), mRNA 
0   NM_165709.1  CG1516-RI, transcript variant I (CG1516), mRNA 
0   NM_165705.1  CG1516-RA, transcript variant A (CG1516), mRNA 
0   NM_165710.1  CG1516-RJ, transcript variant J (CG1516), mRNA 
0   NM_165707.1  CG1516-RD, transcript variant D (CG1516), mRNA 
0   NM_165712.1  CG1516-RL, transcript variant L (CG1516), mRNA 
0   NM_165708.1  CG1516-RG, transcript variant G (CG1516), mRNA 
0   NM_165706.1  CG1516-RB, transcript variant B (CG1516), mRNA 
0   NM_165711.1  CG1516-RK, transcript variant K (CG1516), mRNA 
0   NM_080170.2  CG11156-RA (mus101), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_167455.1  CG12708-RA (CG12708), mRNA 
0   NM_168498.1  CG32103-RB, transcript variant B (CG32103), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.