National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8569R-3 
 Symbol CG8569  Full Name CG8569 
 CG No CG8569  Old CG No CG8569 
 Synonyms CG8569 
 Accession No (Link to NCBI) NM_136951.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCATCCGTATTTGGATGGACAAGCTGAAAAAGGGCGTTGGGCAGCCGGCGACAGTCCTA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCGTTCCCTGCTCAATTTAATGAGTGCAGAAGCAGCCAGTTTATCGGTGAAAAATGCC 120

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     121 ACGGAGCGAGGCATACTGGTGGCCAGAGCAGGCGGCGG-ACGGTCCAAGCGTCTGGCCCT 180

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     181 CGCCTTTTGTCAAAAAGTAAGCCGGCTG-CCCAGCTCACCAATTGATCCGTTCTGCTTCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGTGCCATTTGCCCGGAGCCGTTAAGAAATGCATATCCTGCCATCGCTCCTTCCACGAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATTGCCAGCGACAGGACCCGGAGAAGCCCAATTATTCAGTGCCCTCGGACAAGGGCCAAC 360

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     361 CTTACCAGTTTCCCGTCAACGAATTGGACAATCAG-CCCCTGAATAACACTCAGAACTTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGACTCCCCAAACGCCAACGCCCCTGCTCGATCATAATAGCAACATCAATCAGACTTTG 480

8569R-3.IR_full       481 CTAGCCACTACGGATTTCCTGAA 503
                          ||||||||||||||||||||||| silico     481 CTAGCCACTACGGATTTCCTGAA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136951.2  CG8569-RA (CG8569), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_134656.2  CG3709-RA (CG3709), mRNA 
0   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_132658.1  CG1681-RA (CG1681), mRNA 
0   NM_136859.2  CG8991-RA (Sobp), mRNA 
0   NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_142394.1  CG16766-RA (CG16766), mRNA 
0   NM_136784.3  CG12942-RA (CG12942), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   11  NM_137566.2  CG9834-RA, transcript variant A (endoB), mRNA 
0   11  NM_166340.1  CG9834-RB, transcript variant B (endoB), mRNA 
0   NM_164818.1  CG13387-RA (emb), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_137492.1  CG17669-RA (CG17669), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_139425.1  CG5691-RA (CG5691), mRNA 
0   NM_140302.1  CG5626-RA (CG5626), mRNA 
0   NM_167871.1  CG9155-RB, transcript variant B (Myo61F), mRNA 
0   NM_167872.1  CG9155-RC, transcript variant C (Myo61F), mRNA 
0   NM_167870.1  CG9155-RA, transcript variant A (Myo61F), mRNA 
0   NM_057586.3  CG9155-RD, transcript variant D (Myo61F), mRNA 
0   NM_136558.2  CG8586-RA (CG8586), mRNA 
0   NM_137948.1  CG3520-RA (CG3520), mRNA 
0   NM_139421.3  CG5687-RA (CG5687), mRNA 
0   NM_141067.2  CG7186-RA (SAK), mRNA 
0   10  NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   10  NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.