National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8569R-3 
 Symbol CG8569  Full Name CG8569 
 CG No CG8569  Old CG No CG8569 
 Synonyms CG8569 
 Accession No (Link to NCBI) NM_136951.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCATCCGTATTTGGATGGAC 
 Primer Seq. 3'
aatctagaggtaccTTCAGGAAATCCGTAGTGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCATCCGTA TTTGGATGGA CAAGCTGAAA AAGGGCGTTG GGCAGCCGGC GACAGTCCTA 
0061 GAGCGTTCCC TGCTCAATTT AATGAGTGCA GAAGCAGCCA GTTTATCGGT GAAAAATGCC 
0121 ACGGAGCGAG GCATACTGGT GGCCAGAGCA GGCGGCGGNA CGGTCCAAGC GTCTGGCCCT 
0181 CGCCTTTTGT CAAAAAGTAA GCCGGCTGCC CCAGCTCACC AATTGATCCG TTCTGCTTCG 
0241 AGTGCCATTT GCCCGGAGCC GTTAAGAAAT GCATATCCTG CCATCGCTCC TTCCACGAGA 
0301 ATTGCCAGCG ACAGGACCCG GAGAAGCCCA ATTATTCAGT GCCCTCGGAC AAGGGCCAAC 
0361 CTTACCAGTT TCCCGTCAAC GAATTGGACA ATCAGCCCCC TGAATAACAC TCAGAACTTG 
0421 GAGACTCCCC AAACGCCAAC GCCCCTGCTC GATCATAATA GCAACATCAA TCAGACTTTG 
0481 CTAGCCACTA CGGATTTCCT GAA 
 in silico PCR Fragment
0001 GCCATCCGTA TTTGGATGGA CAAGCTGAAA AAGGGCGTTG GGCAGCCGGC GACAGTCCTA 
0061 GAGCGTTCCC TGCTCAATTT AATGAGTGCA GAAGCAGCCA GTTTATCGGT GAAAAATGCC 
0121 ACGGAGCGAG GCATACTGGT GGCCAGAGCA GGCGGCGG-A CGGTCCAAGC GTCTGGCCCT 
0181 CGCCTTTTGT CAAAAAGTAA GCCGGCTG-C CCAGCTCACC AATTGATCCG TTCTGCTTCG 
0241 AGTGCCATTT GCCCGGAGCC GTTAAGAAAT GCATATCCTG CCATCGCTCC TTCCACGAGA 
0301 ATTGCCAGCG ACAGGACCCG GAGAAGCCCA ATTATTCAGT GCCCTCGGAC AAGGGCCAAC 
0361 CTTACCAGTT TCCCGTCAAC GAATTGGACA ATCAG-CCCC TGAATAACAC TCAGAACTTG 
0421 GAGACTCCCC AAACGCCAAC GCCCCTGCTC GATCATAATA GCAACATCAA TCAGACTTTG 
0481 CTAGCCACTA CGGATTTCCT GAA 
 Assemble Data
<PRE>

8569R-3.IR_full       1   GCCATCCGTATTTGGATGGACAAGCTGAAAAAGGGCGTTGGGCAGCCGGCGACAGTCCTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8569R-3.in silico     1   GCCATCCGTATTTGGATGGACAAGCTGAAAAAGGGCGTTGGGCAGCCGGCGACAGTCCTA 60


8569R-3.IR_full       61  GAGCGTTCCCTGCTCAATTTAATGAGTGCAGAAGCAGCCAGTTTATCGGTGAAAAATGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8569R-3.in silico     61  GAGCGTTCCCTGCTCAATTTAATGAGTGCAGAAGCAGCCAGTTTATCGGTGAAAAATGCC 120


8569R-3.IR_full       121 ACGGAGCGAGGCATACTGGTGGCCAGAGCAGGCGGCGG<span class="snp"><tt>N</tt></span>ACGGTCCAAGCGTCTGGCCCT 180
                          ||||||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||||||||
8569R-3.in silico     121 ACGGAGCGAGGCATACTGGTGGCCAGAGCAGGCGGCGG<span class="snp"><tt>-</tt></span>ACGGTCCAAGCGTCTGGCCCT 180


8569R-3.IR_full       181 CGCCTTTTGTCAAAAAGTAAGCCGGCTG<span class="snp"><tt>C</tt></span>CCCAGCTCACCAATTGATCCGTTCTGCTTCG 240
                          ||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||||||||||||||||||
8569R-3.in silico     181 CGCCTTTTGTCAAAAAGTAAGCCGGCTG<span class="snp"><tt>-</tt></span>CCCAGCTCACCAATTGATCCGTTCTGCTTCG 240


8569R-3.IR_full       241 AGTGCCATTTGCCCGGAGCCGTTAAGAAATGCATATCCTGCCATCGCTCCTTCCACGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8569R-3.in silico     241 AGTGCCATTTGCCCGGAGCCGTTAAGAAATGCATATCCTGCCATCGCTCCTTCCACGAGA 300


8569R-3.IR_full       301 ATTGCCAGCGACAGGACCCGGAGAAGCCCAATTATTCAGTGCCCTCGGACAAGGGCCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8569R-3.in silico     301 ATTGCCAGCGACAGGACCCGGAGAAGCCCAATTATTCAGTGCCCTCGGACAAGGGCCAAC 360


8569R-3.IR_full       361 CTTACCAGTTTCCCGTCAACGAATTGGACAATCAG<span class="snp"><tt>C</tt></span>CCCCTGAATAACACTCAGAACTTG 420
                          |||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||||||||||||
8569R-3.in silico     361 CTTACCAGTTTCCCGTCAACGAATTGGACAATCAG<span class="snp"><tt>-</tt></span>CCCCTGAATAACACTCAGAACTTG 420


8569R-3.IR_full       421 GAGACTCCCCAAACGCCAACGCCCCTGCTCGATCATAATAGCAACATCAATCAGACTTTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8569R-3.in silico     421 GAGACTCCCCAAACGCCAACGCCCCTGCTCGATCATAATAGCAACATCAATCAGACTTTG 480


8569R-3.IR_full       481 CTAGCCACTACGGATTTCCTGAA 503
                          |||||||||||||||||||||||
8569R-3.in silico     481 CTAGCCACTACGGATTTCCTGAA 503

</PRE>
 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136951.2  CG8569-RA (CG8569), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_134656.2  CG3709-RA (CG3709), mRNA 
0   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_132658.1  CG1681-RA (CG1681), mRNA 
0   NM_136859.2  CG8991-RA (Sobp), mRNA 
0   NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_142394.1  CG16766-RA (CG16766), mRNA 
0   NM_136784.3  CG12942-RA (CG12942), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   11  NM_137566.2  CG9834-RA, transcript variant A (endoB), mRNA 
0   11  NM_166340.1  CG9834-RB, transcript variant B (endoB), mRNA 
0   NM_164818.1  CG13387-RA (emb), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_137492.1  CG17669-RA (CG17669), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_139425.1  CG5691-RA (CG5691), mRNA 
0   NM_140302.1  CG5626-RA (CG5626), mRNA 
0   NM_167871.1  CG9155-RB, transcript variant B (Myo61F), mRNA 
0   NM_167872.1  CG9155-RC, transcript variant C (Myo61F), mRNA 
0   NM_167870.1  CG9155-RA, transcript variant A (Myo61F), mRNA 
0   NM_057586.3  CG9155-RD, transcript variant D (Myo61F), mRNA 
0   NM_136558.2  CG8586-RA (CG8586), mRNA 
0   NM_137948.1  CG3520-RA (CG3520), mRNA 
0   NM_139421.3  CG5687-RA (CG5687), mRNA 
0   NM_141067.2  CG7186-RA (SAK), mRNA 
0   10  NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   10  NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 
 Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.