National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8556R-1 
 Symbol Rac2  Full Name Rac2 
 CG No CG8556  Old CG No CG8556 
 Synonyms Drac2, DmRAC2, Rac, rac2, Rac GTPase, D-Rac2, D-Rac 2, CG8556, DRac2, Rac-2, RacB mRNA., Drac1b, Rac1b, DRacB, RacB, Rac2 
 Accession No (Link to NCBI) NM_139864.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCATCAAGTGTGTGGTTGTG 
 Primer Seq. 3'
aatctagaggtaccAAGACCGTCTTCAGACCCTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCATCAAGT GTGTGGTTGT GGGCGACGGA GCGGTGGGAA AGACCTGCCT GCTGATCAGC 
0061 TATACGACCA ACGCCTTCCC CGGCGAGTAC ATACCCACGG TGTTCGACAA CTATTCGGCG 
0121 AATGTGATGG TGGATGCCAA GCCCATCAAT CTGGGCCTCT GGGATACGGC TGGACAGGAG 
0181 GACTACGATC GCCTGAGGCC GCTATCCTAT CCGCAAACGG ATGTCTTTCT CATCTGTTTC 
0241 TCACTGGTGA ATCCGGCATC GTTTGAGAAT GTGCGAGCCA AATGGTTTCC CGAGGTGCGT 
0301 CATCATTGCC CGAGTGTGCC GATAATNCCT GGTCGGCACC AAACTGGATC TGCGCGACGA 
0361 TAAGCAGACG ATCGAGAAGC TGAAGGACAA GAAGCTAACA CCGATCACCT TATCCCCAAG 
0421 GACTGGCGAT GGCCAAGGAA ATAGCTGCGG TCAAGTATCT GGAGTGCTCG GCCCTGAcCC 
0481 AAAAGGGTCT GAAGACGGTC TT 
 in silico PCR Fragment
0001 GCCATCAAGT GTGTGGTTGT GGGCGACGGA GCGGTGGGAA AGACCTGTCT GCTGATCAGC 
0061 TATACGACCA ACGCCTTCCC CGGCGAGTAC ATACCCACGG TGTTCGACAA CTATTCGGCG 
0121 AATGTGATGG TGGATGCCAA GCCCATCAAT CTGGGCCTCT GGGATACGGC TGGACAGGAG 
0181 GACTACGATC GCCTGAGGCC GCTATCCTAT CCGCAAACGG ATGTCTTTCT CATCTGTTTC 
0241 TCACTGGTGA ATCCGGCATC GTTTGAGAAT GTGCGAGCCA AATGGTTTCC CGAGGTGCGT 
0301 CATCATTGCC CGAGTGTGCC GATAAT-CCT GGTCGGCACC AAACTGGATC TGCGCGACGA 
0361 TAAGCAGACG ATCGAGAAGC TGAAGGACAA GAAGCTAACA CCGATCACC- TATCCCCAAG 
0421 GACTGGCGAT GGCCAAGGAA ATAGCTGCGG TCAAGTATCT GGAGTGCTCG GCCCTGACCC 
0481 AAAAGGGTCT GAAGACGGTC TT 
 Assemble Data

8556R-1.IR_full       1   GCCATCAAGTGTGTGGTTGTGGGCGACGGAGCGGTGGGAAAGACCTGCCTGCTGATCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
8556R-1.in silico     1   GCCATCAAGTGTGTGGTTGTGGGCGACGGAGCGGTGGGAAAGACCTGTCTGCTGATCAGC 60


8556R-1.IR_full       61  TATACGACCAACGCCTTCCCCGGCGAGTACATACCCACGGTGTTCGACAACTATTCGGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8556R-1.in silico     61  TATACGACCAACGCCTTCCCCGGCGAGTACATACCCACGGTGTTCGACAACTATTCGGCG 120


8556R-1.IR_full       121 AATGTGATGGTGGATGCCAAGCCCATCAATCTGGGCCTCTGGGATACGGCTGGACAGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8556R-1.in silico     121 AATGTGATGGTGGATGCCAAGCCCATCAATCTGGGCCTCTGGGATACGGCTGGACAGGAG 180


8556R-1.IR_full       181 GACTACGATCGCCTGAGGCCGCTATCCTATCCGCAAACGGATGTCTTTCTCATCTGTTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8556R-1.in silico     181 GACTACGATCGCCTGAGGCCGCTATCCTATCCGCAAACGGATGTCTTTCTCATCTGTTTC 240


8556R-1.IR_full       241 TCACTGGTGAATCCGGCATCGTTTGAGAATGTGCGAGCCAAATGGTTTCCCGAGGTGCGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8556R-1.in silico     241 TCACTGGTGAATCCGGCATCGTTTGAGAATGTGCGAGCCAAATGGTTTCCCGAGGTGCGT 300


8556R-1.IR_full       301 CATCATTGCCCGAGTGTGCCGATAATNCCTGGTCGGCACCAAACTGGATCTGCGCGACGA 360
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
8556R-1.in silico     301 CATCATTGCCCGAGTGTGCCGATAAT-CCTGGTCGGCACCAAACTGGATCTGCGCGACGA 360


8556R-1.IR_full       361 TAAGCAGACGATCGAGAAGCTGAAGGACAAGAAGCTAACACCGATCACCTTATCCCCAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
8556R-1.in silico     361 TAAGCAGACGATCGAGAAGCTGAAGGACAAGAAGCTAACACCGATCACC-TATCCCCAAG 420


8556R-1.IR_full       421 GACTGGCGATGGCCAAGGAAATAGCTGCGGTCAAGTATCTGGAGTGCTCGGCCCTGACCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8556R-1.in silico     421 GACTGGCGATGGCCAAGGAAATAGCTGCGGTCAAGTATCTGGAGTGCTCGGCCCTGACCC 480


8556R-1.IR_full       481 AAAAGGGTCTGAAGACGGTCTT 502
                          ||||||||||||||||||||||
8556R-1.in silico     481 AAAAGGGTCTGAAGACGGTCTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139864.1  CG8556-RA (Rac2), mRNA 
3.73   18  83  145  121  NM_057602.3  CG2248-RA (Rac1), mRNA 
1.03   25  41  56  NM_078690.2  CG12530-RA, transcript variant A (Cdc42), mRNA 
1.03   25  41  56  NM_167677.1  CG12530-RB, transcript variant B (Cdc42), mRNA 
0   12  19  NM_079568.2  CG9366-RA (RhoL), mRNA 
0   41  34  NM_170343.1  CG5588-RA, transcript variant A (Mtl), mRNA 
0   41  34  NM_079809.2  CG5588-RB, transcript variant B (Mtl), mRNA 
0   41  34  NM_170344.1  CG5588-RC, transcript variant C (Mtl), mRNA 
0   NM_166986.2  CG2849-RA, transcript variant A (Rala), mRNA 
0   NM_080324.3  CG2849-RC, transcript variant C (Rala), mRNA 
0   NM_166985.2  CG2849-RB, transcript variant B (Rala), mRNA 
0   NM_057824.3  CG6601-RA (Rab6), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_001042801.1  CG34104-RB, transcript variant B (CG34104), mRNA 
0   NM_001042802.1  CG34104-RA, transcript variant A (CG34104), mRNA 
0   NM_164387.1  CG3022-RB, transcript variant B (GABA-B-R3), mRNA 
0   NM_078723.2  CG3022-RA, transcript variant A (GABA-B-R3), mRNA 
0   NM_130565.2  CG14791-RC, transcript variant C (Rab27), mRNA 
0   NM_166888.1  CG14791-RB, transcript variant B (Rab27), mRNA 
0   NM_133009.2  CG8188-RA, transcript variant A (CG8188), mRNA 
0   NM_001038763.1  CG8188-RB, transcript variant B (CG8188), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_080362.2  CG31868-RA (Samuel), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_139976.1  CG6765-RA (CG6765), mRNA 
0   NM_166870.1  CG32859-RA (eIF4E-7), mRNA 
0   NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   NM_169818.1  CG14307-RH, transcript variant H (fru), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.