National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8549R-4 
 Symbol CG8549  Full Name CG8549 
 CG No CG8549  Old CG No CG8549 
 Synonyms CG8549 
 Accession No (Link to NCBI) NM_139800.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCCAAAATATTCACGCCCAC 
 Primer Seq. 3'
aatctagaggtaccTGGGCATATGGTCCTTGAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCCAAAATA TTCACGCCCA CAAATCAAAT ACGCCTCACA AATGTCGCCA TTGTGAGGCT 
0061 AAAAAAAGGT GGCAAGCGAT TTGAGATCGC CTGCTATAAA AATAAGGTTC TTTCGTGGAG 
0121 GAGCAACAGC GAAAAGGACA TCGATGAGGT CCTGCAAACC CATACCGTGT TCACCAATGT 
0181 CTCCAAAGGA CAGGCGGCCA AAAAGGACGA GCTGCAAAAG GCCTTCAATA AAACAGACGA 
0241 GACTGAGATT TGCAAGGAGA TCCTCAGCAA AGGAGAACTG CAGGTGTCGG AAAAGGAGCG 
0301 CCAAAGTTGT CTGGACACGC AACTAAATAG TATAGTTAAT TCCGTGGCTG CGTTGTGTGT 
0361 AAATCCAGAG ACGCGTCGTC CATATCCCGC CTCCATCATC GAGAAATCCC TGAAGGATGC 
0421 CCACTTCTCC GTTAAGATGA ACAGGAACAC CAAGCAGAAC ACACTGGAGG CCATCAAGAT 
0481 TCTCAAGGAC CATATGCCCA  
 in silico PCR Fragment
0001 GTCCAAAATA TTCACGCCCA CAAATCAAAT ACGCCTCACA AATGTCGCCA TTGTGAGGCT 
0061 AAAAAAAGGT GGCAAGCGAT TTGAGATCGC CTGCTATAAA AATAAGGTTC TTTCGTGGAG 
0121 GAGCAACAGC GAAAAGGACA TCGATGAGGT CCTGCAAACC CATACCGTGT TCACCAATGT 
0181 CTCCAAAGGA CAGGCGGCCA AAAAGGACGA GCTGCAAAAG GCCTTCAATA AAACAGACGA 
0241 GACTGAGATT TGCAAGGAGA TCCTCAGCAA AGGAGAACTG CAGGTGTCGG AAAAGGAGCG 
0301 CCAAAGTTGT CTGGACACGC AACTAAATAG TATAGTTAAT TCCGTGGCTG CGTTGTGTGT 
0361 AAATCCAGAG ACGCGTCGTC CATATCCCGC CTCCATCATC GAGAAATCCC TGAAGGATGC 
0421 CCACTTCTCC GTTAAGATGA ACAGGAACAC CAAGCAGAAC ACACTGGAGG CCATCAAGAT 
0481 TCTCAAGGAC CATATGCCCA  
 Assemble Data

8549R-4.IR_full       1   GTCCAAAATATTCACGCCCACAAATCAAATACGCCTCACAAATGTCGCCATTGTGAGGCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     1   GTCCAAAATATTCACGCCCACAAATCAAATACGCCTCACAAATGTCGCCATTGTGAGGCT 60


8549R-4.IR_full       61  AAAAAAAGGTGGCAAGCGATTTGAGATCGCCTGCTATAAAAATAAGGTTCTTTCGTGGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     61  AAAAAAAGGTGGCAAGCGATTTGAGATCGCCTGCTATAAAAATAAGGTTCTTTCGTGGAG 120


8549R-4.IR_full       121 GAGCAACAGCGAAAAGGACATCGATGAGGTCCTGCAAACCCATACCGTGTTCACCAATGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     121 GAGCAACAGCGAAAAGGACATCGATGAGGTCCTGCAAACCCATACCGTGTTCACCAATGT 180


8549R-4.IR_full       181 CTCCAAAGGACAGGCGGCCAAAAAGGACGAGCTGCAAAAGGCCTTCAATAAAACAGACGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     181 CTCCAAAGGACAGGCGGCCAAAAAGGACGAGCTGCAAAAGGCCTTCAATAAAACAGACGA 240


8549R-4.IR_full       241 GACTGAGATTTGCAAGGAGATCCTCAGCAAAGGAGAACTGCAGGTGTCGGAAAAGGAGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     241 GACTGAGATTTGCAAGGAGATCCTCAGCAAAGGAGAACTGCAGGTGTCGGAAAAGGAGCG 300


8549R-4.IR_full       301 CCAAAGTTGTCTGGACACGCAACTAAATAGTATAGTTAATTCCGTGGCTGCGTTGTGTGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     301 CCAAAGTTGTCTGGACACGCAACTAAATAGTATAGTTAATTCCGTGGCTGCGTTGTGTGT 360


8549R-4.IR_full       361 AAATCCAGAGACGCGTCGTCCATATCCCGCCTCCATCATCGAGAAATCCCTGAAGGATGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     361 AAATCCAGAGACGCGTCGTCCATATCCCGCCTCCATCATCGAGAAATCCCTGAAGGATGC 420


8549R-4.IR_full       421 CCACTTCTCCGTTAAGATGAACAGGAACACCAAGCAGAACACACTGGAGGCCATCAAGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8549R-4.in silico     421 CCACTTCTCCGTTAAGATGAACAGGAACACCAAGCAGAACACACTGGAGGCCATCAAGAT 480


8549R-4.IR_full       481 TCTCAAGGACCATATGCCCA 500
                          ||||||||||||||||||||
8549R-4.in silico     481 TCTCAAGGACCATATGCCCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139800.2  CG8549-RA (CG8549), mRNA 
0   NM_132577.1  CG2556-RA (CG2556), mRNA 
0   NM_136518.3  CG2183-RA (CG2183), mRNA 
0   NM_057768.2  CG7779-RA (Cng), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_080049.2  CG11614-RA (nkd), mRNA 
0   NM_079864.2  CG1470-RA (Gycbeta100B), mRNA 
0   NM_165535.1  CG2146-RC, transcript variant C (didum), mRNA 
0   NM_057838.3  CG2146-RA, transcript variant A (didum), mRNA 
0   NM_165536.1  CG2146-RB, transcript variant B (didum), mRNA 
0   NM_164638.1  CG14025-RC, transcript variant C (Bsg25D), mRNA 
0   NM_164637.1  CG14025-RB, transcript variant B (Bsg25D), mRNA 
0   NM_144381.1  CG15378-RA (lectin-22C), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   NM_141864.1  CG6950-RB, transcript variant B (CG6950), mRNA 
0   NM_176463.1  CG6950-RD, transcript variant D (CG6950), mRNA 
0   NM_169437.2  CG6950-RA, transcript variant A (CG6950), mRNA 
0   NM_080088.1  CG6577-RA (can), mRNA 
0   NM_001015093.1  CG41041-PA.3 (CG41041), mRNA 
0   NM_169438.1  CG6950-RC, transcript variant C (CG6950), mRNA 
0   NM_132953.1  CG13001-RA (CG13001), mRNA 
0   NM_142307.1  CG12783-RA (CG12783), mRNA 
0   NM_132170.1  CG11369-RA (CG11369), mRNA 
0   NM_057534.3  CG3242-RA (sob), mRNA 
0   NM_143223.1  CG14238-RA (CG14238), mRNA 
0   NM_140520.1  CG7427-RA (CG7427), mRNA 
0   NM_137241.1  CG8424-RA (Jhedup), mRNA 
0   NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   NM_141965.1  CG14395-RA (CG14395), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.