National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8547R-2 
 Symbol CG8547  Full Name CG8547 
 CG No CG8547  Old CG No CG8547 
 Synonyms CG8547 
 Accession No (Link to NCBI) NM_137103.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCGAGTTCTGGCGACAACA 
 Primer Seq. 3'
aatctagaggtaccAATGGTGGTGCCGCTGGTCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCGAGTTC TGGCGACAAC AATGTCTCGT ATCAGGGCAA ATCCCCCGAC CAGAACATAG 
0061 ATCAATTGGA TGCCTTGTTG GAGGATCTGA AGCAGGAACG ACAGATTACC AACAGGGAAC 
0121 GCGATCTGCT GCCCAGCAAT GGAACCACTT ATAGGACACT TGAACGCACT GATCCCTCGG 
0181 GCACCGTAAC GAGGACTACG CGAGTGGTCA AGACCAGCAN AGCACTCGGG CACCGGTGGC 
0241 CAGCAGCCAT TTATTGATGA TGTGGAGACC TTCAGTCCCA CCGACTACAG CACCCTGCAG 
0301 TCCACGGCCA AGTACTCCAG CTTGAAGAGG GACGAGTTCC AGACCAAGGA CAAGCCCTAT 
0361 ACTCTGGCCC ACTCCCCCAG TGGTGGACAC TACGAGAGCA AGTCGAAGAT CTACGAAAGC 
0421 AATCGCACCA TTAACAACAA TGTGGAGCTG CTGCTCTGCA ACGAGCAGCA CACATCAGAC 
0481 TTTGATCCAG CGGCACCACC ATT 
 in silico PCR Fragment
0001 ACTCGAGTTC TGGCGACAAC AATGTCTCGT ATCAGGGCAA ATCCCCCGAC CAGAACATAG 
0061 ATCAATTGGA TGCCTTGTTG GAGGATCTGA AGCAGGAACG ACAGATTACC AACAGGGAAC 
0121 GCGATCTGCT GCCCAGCAAT GGAACCACTT ATAGGACACT TGAACGCACT GATCCCTCGG 
0181 GCACCGTAAC GAGGACTACG CGAGTGGTCA AGACCAGCA- AGCACTCGGG CACCGGTGGC 
0241 CAGCAGCCAT TTATTGATGA TGTGGAGACC TTCAGTCCCA CCGACTACAG CACCCTGCAG 
0301 TCCACGGCCA AGTACTCCAG CTTGAAGAGG GACGAGTTCC AGACCAAGGA CAAGCCCTAT 
0361 ACTCTGGCCC ACTCCCCCAG TGGTGGACAC TACGAGAGCA AGTCGAAGAT CTACGAAAGC 
0421 AATCGCACCA TTAACAACAA TGTGGAGCTG CTGC-CTGCA ACGAGCAGCA CACATCAGAC 
0481 TTTGA-CCAG CGGCACCACC ATT 
 Assemble Data

8547R-2.IR_full       1   ACTCGAGTTCTGGCGACAACAATGTCTCGTATCAGGGCAAATCCCCCGACCAGAACATAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8547R-2.in silico     1   ACTCGAGTTCTGGCGACAACAATGTCTCGTATCAGGGCAAATCCCCCGACCAGAACATAG 60


8547R-2.IR_full       61  ATCAATTGGATGCCTTGTTGGAGGATCTGAAGCAGGAACGACAGATTACCAACAGGGAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8547R-2.in silico     61  ATCAATTGGATGCCTTGTTGGAGGATCTGAAGCAGGAACGACAGATTACCAACAGGGAAC 120


8547R-2.IR_full       121 GCGATCTGCTGCCCAGCAATGGAACCACTTATAGGACACTTGAACGCACTGATCCCTCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8547R-2.in silico     121 GCGATCTGCTGCCCAGCAATGGAACCACTTATAGGACACTTGAACGCACTGATCCCTCGG 180


8547R-2.IR_full       181 GCACCGTAACGAGGACTACGCGAGTGGTCAAGACCAGCANAGCACTCGGGCACCGGTGGC 240
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
8547R-2.in silico     181 GCACCGTAACGAGGACTACGCGAGTGGTCAAGACCAGCA-AGCACTCGGGCACCGGTGGC 240


8547R-2.IR_full       241 CAGCAGCCATTTATTGATGATGTGGAGACCTTCAGTCCCACCGACTACAGCACCCTGCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8547R-2.in silico     241 CAGCAGCCATTTATTGATGATGTGGAGACCTTCAGTCCCACCGACTACAGCACCCTGCAG 300


8547R-2.IR_full       301 TCCACGGCCAAGTACTCCAGCTTGAAGAGGGACGAGTTCCAGACCAAGGACAAGCCCTAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8547R-2.in silico     301 TCCACGGCCAAGTACTCCAGCTTGAAGAGGGACGAGTTCCAGACCAAGGACAAGCCCTAT 360


8547R-2.IR_full       361 ACTCTGGCCCACTCCCCCAGTGGTGGACACTACGAGAGCAAGTCGAAGATCTACGAAAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8547R-2.in silico     361 ACTCTGGCCCACTCCCCCAGTGGTGGACACTACGAGAGCAAGTCGAAGATCTACGAAAGC 420


8547R-2.IR_full       421 AATCGCACCATTAACAACAATGTGGAGCTGCTGCTCTGCAACGAGCAGCACACATCAGAC 480
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
8547R-2.in silico     421 AATCGCACCATTAACAACAATGTGGAGCTGCTGC-CTGCAACGAGCAGCACACATCAGAC 480


8547R-2.IR_full       481 TTTGATCCAGCGGCACCACCATT 503
                          ||||| |||||||||||||||||
8547R-2.in silico     481 TTTGA-CCAGCGGCACCACCATT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137103.2  CG8547-RA, transcript variant A (CG8547), mRNA 
100   482  NM_166044.1  CG8547-RB, transcript variant B (CG8547), mRNA 
0   NM_137247.1  CG8434-RA (lbk), mRNA 
0   NM_169061.1  CG8434-RA (lbk), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG8434-RA (lbk), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_143021.2  CG5796-RA (Ppox), mRNA 
0   NM_143705.2  CG12225-RA (Spt6), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_079039.2  CG8380-RA (DAT), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_133101.2  CG7101-RA (CG7101), mRNA 
0   NM_137915.3  CG3219-RA (Klp59C), mRNA 
0   NM_078650.2  CG9802-RA, transcript variant A (Cap), mRNA 
0   NM_167525.1  CG9802-RB, transcript variant B (Cap), mRNA 
0   NM_134898.1  CG17258-RA (CG17258), mRNA 
0   NM_167649.1  CG32533-RA (CG32533), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_079262.2  CG5008-RA (GNBP3), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_143372.1  CG9995-RA (htt), mRNA 
0   19  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   12  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   NM_080378.2  CG1744-RA (chp), mRNA,2-N-acetylglucosaminyltransferase I CG13431-RA (Mgat1), mRNA 
0   NM_136527.1  CG14755-RA (CG14755), mRNA 
0   NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   14  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   13  NM_078653.1  CG18572-RA, transcript variant A (r), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.