National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8547R-1 
 Symbol CG8547  Full Name CG8547 
 CG No CG8547  Old CG No CG8547 
 Synonyms CG8547 
 Accession No (Link to NCBI) NM_137103.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTCGAGTTCTGGCGACAACAATGTCTCGTATCAGGGCAAATCCCCCGACCAGAACATAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCAATTGGATGCCTTGTTGGAGGATCTGAAGCAGGAACGACAGATTACCAACAGGGAAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCGATCTGCTGCCCAGCAATGGAACCACTTATAGGACACTTGAACGCACTGATCCCTCGG 180

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     181 GCACCGTAACGAGGACTACGCGAGTGGTCAAGACCAGCA-AGCACTCGGGCACCGGTGGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGCAGCCATTTATTGATGATGTGGAGACCTTCAGTCCCACCGACTACAGCACCCTGCAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCCACGGCCAAGTACTCCAGCTTGAAGAGGGACGAGTTCCAGACCAAGGACAAGCCCTAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACTCTGGCCCACTCCCCCAGTGGTGGACACTACGAGAGCAAGTCGAAGATCTACGAAAGC 420

                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     421 AATCGCACCATTAACAACAATGTGGAGCTGCTGC-CTGCAACGAGCAGCACACATCAGAC 480

8547R-1.IR_full       481 TTTGATCCAGCGGCACCACCATT 503
                          ||||| ||||||||||||||||| silico     481 TTTGA-CCAGCGGCACCACCATT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137103.2  CG8547-RA, transcript variant A (CG8547), mRNA 
100   482  NM_166044.1  CG8547-RB, transcript variant B (CG8547), mRNA 
0   NM_137247.1  CG8434-RA (lbk), mRNA 
0   NM_169061.1  CG8434-RA (lbk), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG8434-RA (lbk), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_143021.2  CG5796-RA (Ppox), mRNA 
0   NM_143705.2  CG12225-RA (Spt6), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_079039.2  CG8380-RA (DAT), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_133101.2  CG7101-RA (CG7101), mRNA 
0   NM_137915.3  CG3219-RA (Klp59C), mRNA 
0   NM_078650.2  CG9802-RA, transcript variant A (Cap), mRNA 
0   NM_167525.1  CG9802-RB, transcript variant B (Cap), mRNA 
0   NM_134898.1  CG17258-RA (CG17258), mRNA 
0   NM_167649.1  CG32533-RA (CG32533), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_079262.2  CG5008-RA (GNBP3), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_143372.1  CG9995-RA (htt), mRNA 
0   19  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   12  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   NM_080378.2  CG1744-RA (chp), mRNA,2-N-acetylglucosaminyltransferase I CG13431-RA (Mgat1), mRNA 
0   NM_136527.1  CG14755-RA (CG14755), mRNA 
0   NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   14  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   13  NM_078653.1  CG18572-RA, transcript variant A (r), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.