National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8541R-3 
 Symbol CG8541  Full Name CG8541 
 CG No CG8541  Old CG No CG8541 
 Synonyms CG8541 
 Accession No (Link to NCBI) NM_139870.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCTCATCTCTCTGTGCGCCC 
 Primer Seq. 3'
aatctagaggtaccTGGAGCAGGAGCAGCGTAAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCTCATCTC TCTGTGCGCC CTGGTGGcCT GCGCCAATGC TGGTCTCTTG GCCAGCCATG 
0061 TGGCCATTGC CAATCCGTCG GTGGATGCCG TCGCCTCCAC TCAGCAAAAT GTGGTGAGGT 
0121 CCTTTGCCGG TACTGTTTCC AGCTACTCAA AGGCGGTGGA CACCCCGTAC TCCAGTGTGA 
0181 GGAAGAGCGA CACGAGGATC CAGAACAATG TATACACTCC TGCTATTAAG ACGACCACTT 
0241 ATGGTGCTGC TCCTCTGTAC ACTCAGGCTA CTCCCATTGN GTCCAAGACT CTGGTCCATG 
0301 CTCCAGCTCC CGTTGTTGAG AAGACTGTGT NCGCTGCTGC TCCAGCTCCA GTTCTGGCCA 
0361 AGACTGTTTA CTNCGCTCCT GCTCCAGTTG TgGCCAAGCA CGTTTATTNC GCTCCAGCTC 
0421 AGGTTTATGC TCCTGCCGCC CCAGTTGTGG CCAAGACCGT GTACTCTGCT CCTGCTCCAG 
0481 TTTACGCTGC TCCTGCTCCA  
 in silico PCR Fragment
0001 ATCTCATCTC TCTGTGCGCC CTGGTGGCCT GCGCCAATGC TGGTCTCTTG GCCAGCCATG 
0061 TGGCCATTGC TAATCCGTCG GTGGATGCCG TCGCCTCCAC TCAGCAGAAT GTGGTGAGGT 
0121 CCTTTGCCGG TACTGTTTCC AGCTACTCGA AGGCGGTGGA CACCCCCTAC TCCAGTGTGA 
0181 GGAAGAGCGA CACGAGGATC CAGAACAATG TATACACTCC TGCTATTAAG ACGACCACTT 
0241 ATGGTGCTGC TCCTCTGTAC ACTCAGGCTA CTCCCATTGT GTCCAAGACT CTGGTCCATG 
0301 CTCCAGCTCC CGTTGTTGAG AAGACTGTGT ACGCTGCTGC TCCAGCTCCA GTTCTGGCCA 
0361 AGACTGTTTA CTCCGCTCCT GCTCCAGTTG TGGCCAAGCA CGTTTATTCC GCTCCAGCTC 
0421 AGGTTTATGC TCCTGCCGCC CCAGTTGTGG CCAAGACCGT GTACTCTGCT CCTGCTCCAG 
0481 TTTACGCTGC TCCTGCTCCA  
 Assemble Data

8541R-3.IR_full       1   ATCTCATCTCTCTGTGCGCCCTGGTGGCCTGCGCCAATGCTGGTCTCTTGGCCAGCCATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8541R-3.in silico     1   ATCTCATCTCTCTGTGCGCCCTGGTGGCCTGCGCCAATGCTGGTCTCTTGGCCAGCCATG 60


8541R-3.IR_full       61  TGGCCATTGCCAATCCGTCGGTGGATGCCGTCGCCTCCACTCAGCAAAATGTGGTGAGGT 120
                          |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||
8541R-3.in silico     61  TGGCCATTGCTAATCCGTCGGTGGATGCCGTCGCCTCCACTCAGCAGAATGTGGTGAGGT 120


8541R-3.IR_full       121 CCTTTGCCGGTACTGTTTCCAGCTACTCAAAGGCGGTGGACACCCCGTACTCCAGTGTGA 180
                          |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||
8541R-3.in silico     121 CCTTTGCCGGTACTGTTTCCAGCTACTCGAAGGCGGTGGACACCCCCTACTCCAGTGTGA 180


8541R-3.IR_full       181 GGAAGAGCGACACGAGGATCCAGAACAATGTATACACTCCTGCTATTAAGACGACCACTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8541R-3.in silico     181 GGAAGAGCGACACGAGGATCCAGAACAATGTATACACTCCTGCTATTAAGACGACCACTT 240


8541R-3.IR_full       241 ATGGTGCTGCTCCTCTGTACACTCAGGCTACTCCCATTGNGTCCAAGACTCTGGTCCATG 300
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
8541R-3.in silico     241 ATGGTGCTGCTCCTCTGTACACTCAGGCTACTCCCATTGTGTCCAAGACTCTGGTCCATG 300


8541R-3.IR_full       301 CTCCAGCTCCCGTTGTTGAGAAGACTGTGTNCGCTGCTGCTCCAGCTCCAGTTCTGGCCA 360
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
8541R-3.in silico     301 CTCCAGCTCCCGTTGTTGAGAAGACTGTGTACGCTGCTGCTCCAGCTCCAGTTCTGGCCA 360


8541R-3.IR_full       361 AGACTGTTTACTNCGCTCCTGCTCCAGTTGTGGCCAAGCACGTTTATTNCGCTCCAGCTC 420
                          |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||
8541R-3.in silico     361 AGACTGTTTACTCCGCTCCTGCTCCAGTTGTGGCCAAGCACGTTTATTCCGCTCCAGCTC 420


8541R-3.IR_full       421 AGGTTTATGCTCCTGCCGCCCCAGTTGTGGCCAAGACCGTGTACTCTGCTCCTGCTCCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8541R-3.in silico     421 AGGTTTATGCTCCTGCCGCCCCAGTTGTGGCCAAGACCGTGTACTCTGCTCCTGCTCCAG 480


8541R-3.IR_full       481 TTTACGCTGCTCCTGCTCCA 500
                          ||||||||||||||||||||
8541R-3.in silico     481 TTTACGCTGCTCCTGCTCCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
102.69  495  51  121  219  NM_139870.1  CG8541-RA (CG8541), mRNA 
3.11   15  54  103  171  NM_139869.1  CG8543-RA (CG8543), mRNA 
1.03   38  66  NM_167394.1  CG32603-RA (CG32603), mRNA 
0.62   43  118  NM_167559.1  CG32564-RA (CG32564), mRNA 
0.62   16  NM_140605.1  CG13047-RA (CG13047), mRNA 
0.41   79  198  273  NM_136257.2  CG8677-RA (CG8677), mRNA 
0.41   79  198  271  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0.41   79  198  271  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0.41   27  94  144  NM_132384.2  CG2962-RA (CG2962), mRNA 
0.2   10  NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0.2   11  NM_164717.1  CG10806-RA, transcript variant A (CG10806), mRNA 
0.2   11  NM_135236.2  CG10806-RB, transcript variant B (CG10806), mRNA 
0   35  113  NM_137355.1  CG10953-RA (CG10953), mRNA 
0   13  19  NM_139618.2  CG1259-RB (CG1259), mRNA 
0   15  NM_135121.2  CG8965-RA (CG8965), mRNA 
0   16  NM_143560.1  CG15541-RA (CG15541), mRNA 
0   38  185  NM_132713.1  CG11584-RB (CG11584), mRNA 
0   10  31  NM_140611.2  CG13043-RA (CG13043), mRNA 
0   10  NM_140599.1  CG13068-RA (CG13068), mRNA 
0   10  NM_132445.1  CG1567-RA (C901), mRNA 
0   NM_140618.1  CG13040-RA (CG13040), mRNA 
0   NM_141370.1  CG15591-RA (Osi8), mRNA 
0   14  71  NM_140858.2  CG18294-RA (CG18294), mRNA 
0   18  NM_141422.2  CG1330-RA (Ccp84Ae), mRNA 
0   11  NM_168657.1  CG13049-RA, transcript variant A (CG13049), mRNA 
0   11  NM_140603.1  CG13049-RB, transcript variant B (CG13049), mRNA 
0   16  NR_002490.1  CG13049-RB, transcript variant B (CG13049), mRNA, miscRNA 
0   16  NM_168799.1  CG32212-RA (CG32212), mRNA 
0   11  NM_079576.1  CG12809-RA (nerfin-2), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.