National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8541R-1 
 Symbol CG8541  Full Name CG8541 
 CG No CG8541  Old CG No CG8541 
 Synonyms CG8541 
 Accession No (Link to NCBI) NM_139870.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATCTCATCTCTCTGTGCGCCCTGGTGGCCTGCGCCAATGCTGGTCTCTTGGCCAGCCATG 60

                          |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| silico     61  TGGCCATTGCTAATCCGTCGGTGGATGCCGTCGCCTCCACTCAGCAGAATGTGGTGAGGT 120

                          |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| silico     121 CCTTTGCCGGTACTGTTTCCAGCTACTCGAAGGCGGTGGACACCCCCTACTCCAGTGTGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGAAGAGCGACACGAGGATCCAGAACAATGTATACACTCCTGCTATTAAGACGACCACTT 240

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     241 ATGGTGCTGCTCCTCTGTACACTCAGGCTACTCCCATTGTGTCCAAGACTCTGGTCCATG 300

                          |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     301 CTCCAGCTCCCGTTGTTGAGAAGACTGTGTACGCTGCTGCTCCAGCTCCAGTTCTGGCCA 360

                          |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| silico     361 AGACTGTTTACTCCGCTCCTGCTCCAGTTGTGGCCAAGCACGTTTATTCCGCTCCAGCTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGTTTATGCTCCTGCCGCCCCAGTTGTGGCCAAGACCGTGTACTCTGCTCCTGCTCCAG 480

8541R-1.IR_full       481 TTTACGCTGCTCCTGCTCCA 500
                          |||||||||||||||||||| silico     481 TTTACGCTGCTCCTGCTCCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
102.69  495  51  121  219  NM_139870.1  CG8541-RA (CG8541), mRNA 
3.11   15  54  103  171  NM_139869.1  CG8543-RA (CG8543), mRNA 
1.03   38  66  NM_167394.1  CG32603-RA (CG32603), mRNA 
0.62   43  118  NM_167559.1  CG32564-RA (CG32564), mRNA 
0.62   16  NM_140605.1  CG13047-RA (CG13047), mRNA 
0.41   79  198  273  NM_136257.2  CG8677-RA (CG8677), mRNA 
0.41   79  198  271  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0.41   79  198  271  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0.41   27  94  144  NM_132384.2  CG2962-RA (CG2962), mRNA 
0.2   10  NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0.2   11  NM_164717.1  CG10806-RA, transcript variant A (CG10806), mRNA 
0.2   11  NM_135236.2  CG10806-RB, transcript variant B (CG10806), mRNA 
0   35  113  NM_137355.1  CG10953-RA (CG10953), mRNA 
0   13  19  NM_139618.2  CG1259-RB (CG1259), mRNA 
0   15  NM_135121.2  CG8965-RA (CG8965), mRNA 
0   16  NM_143560.1  CG15541-RA (CG15541), mRNA 
0   38  185  NM_132713.1  CG11584-RB (CG11584), mRNA 
0   10  31  NM_140611.2  CG13043-RA (CG13043), mRNA 
0   10  NM_140599.1  CG13068-RA (CG13068), mRNA 
0   10  NM_132445.1  CG1567-RA (C901), mRNA 
0   NM_140618.1  CG13040-RA (CG13040), mRNA 
0   NM_141370.1  CG15591-RA (Osi8), mRNA 
0   14  71  NM_140858.2  CG18294-RA (CG18294), mRNA 
0   18  NM_141422.2  CG1330-RA (Ccp84Ae), mRNA 
0   11  NM_168657.1  CG13049-RA, transcript variant A (CG13049), mRNA 
0   11  NM_140603.1  CG13049-RB, transcript variant B (CG13049), mRNA 
0   16  NR_002490.1  CG13049-RB, transcript variant B (CG13049), mRNA, miscRNA 
0   16  NM_168799.1  CG32212-RA (CG32212), mRNA 
0   11  NM_079576.1  CG12809-RA (nerfin-2), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.