National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8536R-2 
 Symbol beta4GalNAcTA  Full Name beta4GalNAcTA 
 CG No CG8536  Old CG No CG8536 
 Synonyms CG8536, BcDNA:GH13356, dbeta4GalTA, beta4GalTA, anon-WO0118547.128, beta4GalNAcTA, b4GalNAcTA, beta4Gal-NAcTA, DmGalT 
 Accession No (Link to NCBI)  
 Inserted Chr. ll&lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGATATGCTTGTTGCTGGTG 
 Primer Seq. 3'
aatctagaggtaccTGATGCTGGGCATTGCAGTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8536R-2.IR full       1   ----TATGCTTGTTGCTGGTGCTTAACTTTGTGGGCTTCCGTTCCGACGGAGGTAGCGCC 60
                              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     1   GCGATATGCTTGTTGCTGGTGCTTAACTTTGTGGGCTTCCGTTCCGACGGAGGTAGCGCC 60


8536R-2.IR full       61  ACCTCCCTCAGCAAGCTCAGCATTCGGCGCGTGCACAAGTATGCTCATATCTACGGGAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     61  ACCTCCCTCAGCAAGCTCAGCATTCGGCGCGTGCACAAGTATGCTCATATCTACGGGAAC 120


8536R-2.IR full       121 GCTAGCAGCGATGGAGCCGGAGGCAGTNAAGCATCCAGGCTGCCCGCTTCCCCGCTCGCC 180
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8536R-2.in silico     121 GCTAGCAGCGATGGAGCCGGAGGCAGTGAAGCATCCAGGCTGCCCGCTTCCCCGCTCGCC 180


8536R-2.IR full       181 TTATCAAAAGACAGAGAGCGGGACCAGGAGCTCAATGGCGGACCCAACTCTACCATAAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     181 TTATCAAAAGACAGAGAGCGGGACCAGGAGCTCAATGGCGGACCCAACTCTACCATAAGA 240


8536R-2.IR full       241 ACTGTGATTGCCACGGCAAACTTTACTTCCATTCCACAAGACTTAACGCGCTTCCTGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     241 ACTGTGATTGCCACGGCAAACTTTACTTCCATTCCACAAGACTTAACGCGCTTCCTGCTG 300


8536R-2.IR full       301 GGCACAAAGAAATTTTTGCCCCCGCGACAGAAATCCACATCCGCCCTCCTTGCCAACTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     301 GGCACAAAGAAATTTTTGCCCCCGCGACAGAAATCCACATCCGCCCTCCTTGCCAACTGC 360


8536R-2.IR full       361 ACTGATCCCGATCCCCGTGATGGTGGACCCATCACGCCCAACACGACACTGGAGTCACTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     361 ACTGATCCCGATCCCCGTGATGGTGGACCCATCACGCCCAACACGACACTGGAGTCACTG 420


8536R-2.IR full       421 GACGTTATTGAGGCGGAGCTTGGACCTCTTTTGCGCCCTGGTGGCGCCTTCGAGCCTGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-2.in silico     421 GACGTTATTGAGGCGGAGCTTGGACCTCTTTTGCGCCCTGGTGGCGCCTTCGAGCCTGAA 480


8536R-2.IR full       481 AACTGCAATGCCCAGCATCA 500
                          ||||||||||||||||||||
8536R-2.in silico     481 AACTGCAATGCCCAGCATCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137102.2  beta4GalNAcTA CG8536-RA (beta4GalNAcTA), mRNA 
NM_058041.2  CG12467-RA (CG12467), mRNA 
NM_206607.1  CG3857-RA (CG3857), mRNA 
NM_167095.1  Smg1 CG32743-RA (Smg1), mRNA 
NM_168677.1  CG32164-RA (CG32164), mRNA 
NM_169947.1  SNF4/AMP-activated protein kinase gamma subunit CG17299-RF, transcript variant F (SNF4Agamma), mRNA 
NM_078509.2  deltex CG3929-RA (dx), mRNA 
NM_135680.1  CG14943-RA (CG14943), mRNA 
NM_137600.2  Odorant-binding protein 56d CG11218-RA (Obp56d), mRNA 
NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
NM_132562.1  CG12720-RA (CG12720), mRNA 
NM_078872.4  bicoid stability factor CG10302-RA (bsf), mRNA 
NM_057841.3  daughterless CG5102-RA (da), mRNA 
NM_078677.2  Transferrin 1 CG6186-RA (Tsf1), mRNA 
NM_132538.1  CG15737-RA (CG15737), mRNA 
NM_136069.2  CG10600-RA (CG10600), mRNA 
NM_206678.1  sprint CG33175-RA, transcript variant A (spri), mRNA 
NM_176723.2  sprint CG33175-RG, transcript variant G (spri), mRNA 
12  NM_134544.1  HERC2 CG11734-RB (HERC2), mRNA 
NM_142649.2  CG4000-RA (CG4000), mRNA 
NM_132302.3  dalao CG7055-RA (dalao), mRNA 
NM_078662.2  BarH2 CG5488-RA (B-H2), mRNA 
NM_080054.2  myospheroid CG1560-RA (mys), mRNA 
NM_057215.3  abrupt CG4807-RB, transcript variant B (ab), mRNA 
NM_057214.3  abrupt CG4807-RA, transcript variant A (ab), mRNA 
NM_132957.1  CG9059-RB, transcript variant B (CG9059), mRNA 
NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
NM_079757.3  nicotinic Acetylcholine Receptor alpha 96Aa CG5610-RA (nAcRalpha-96Aa), mRNA 
NM_165658.1  lightoid CG8024-RD, transcript variant D (ltd), mRNA 
NM_165659.1  lightoid CG8024-RC, transcript variant C (ltd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.