National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8536R-1 
 Symbol beta4GalNAcTA  Full Name beta4GalNAcTA 
 CG No CG8536  Old CG No CG8536 
 Synonyms CG8536, BcDNA:GH13356, dbeta4GalTA, beta4GalTA, anon-WO0118547.128, beta4GalNAcTA, b4GalNAcTA, beta4Gal-NAcTA, DmGalT 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGATATGCTTGTTGCTGGTG 
 Primer Seq. 3'
aatctagaggtaccTGATGCTGGGCATTGCAGTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TATGCTTGTT GCTGGTGCTT AACTTTGTGG GCTTCCGTTC CGACGGAGGT AGCGCCACCT 
0061 CCCTCAGCAA GCTCAGCATT CGGCGCGTGC ACAAGTATGC TCATATCTAC GGGAACGCTA 
0121 GCAGCGATGG AGCCGGAGGC AGTNAAGCAT CCAGGCTGCC CGCTTCCCCG CTCGCCTTAT 
0181 CAAAAGACAG AGAGCGGGAC CAGGAGCTCA ATGGCGGACC CAACTCTACC ATAAGAACTG 
0241 TGATTGCCAC GGCAAACTTT ACTTCCATTC CACAAGACTT AACGCGCTTC CTGCTGGGCA 
0301 CAAAGAAATT TTTGCCCCCG CGACAGAAAT CCACATCCGC CCTCCTTGCC AACTGCACTG 
0361 ATCCCGATCC CCGTGATGGT GGACCCATCA CGCCCAACAC GACACTGGAG TCACTGGACG 
0421 TTATTGAGGC GGAGCTTGGA CCTCTTTTGC GCCCTGGTGG CGCCTTCGAG CCTGAAAACT 
0481 GCAATGCCCA GCATCA 
 in silico PCR Fragment
0001 gcgatatgct tgttgctggt gcttaacttt gtgggcttcc gttccgacgg aggtagcgcc 
0061 acctccctca gcaagctcag cattcggcgc gtgcacaagt atgctcatat ctacgggaac 
0121 gctagcagcg atggagccgg aggcagtgaa gcatccaggc tgcccgcttc cccgctcgcc 
0181 ttatcaaaag acagagagcg ggaccaggag ctcaatggcg gacccaactc taccataaga 
0241 actgtgattg ccacggcaaa ctttacttcc attccacaag acttaacgcg cttcctgctg 
0301 ggcacaaaga aatttttgcc cccgcgacag aaatccacat ccgccctcct tgccaactgc 
0361 actgatcccg atccccgtga tggtggaccc atcacgccca acacgacact ggagtcactg 
0421 gacgttattg aggcggagct tggacctctt ttgcgccctg gtggcgcctt cgagcctgaa 
0481 aactgcaatg cccagcatca  
 Assemble Data

8536R-1.IR full       1   ----TATGCTTGTTGCTGGTGCTTAACTTTGTGGGCTTCCGTTCCGACGGAGGTAGCGCC 60
                              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     1   GCGATATGCTTGTTGCTGGTGCTTAACTTTGTGGGCTTCCGTTCCGACGGAGGTAGCGCC 60


8536R-1.IR full       61  ACCTCCCTCAGCAAGCTCAGCATTCGGCGCGTGCACAAGTATGCTCATATCTACGGGAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     61  ACCTCCCTCAGCAAGCTCAGCATTCGGCGCGTGCACAAGTATGCTCATATCTACGGGAAC 120


8536R-1.IR full       121 GCTAGCAGCGATGGAGCCGGAGGCAGTNAAGCATCCAGGCTGCCCGCTTCCCCGCTCGCC 180
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8536R-1.in silico     121 GCTAGCAGCGATGGAGCCGGAGGCAGTGAAGCATCCAGGCTGCCCGCTTCCCCGCTCGCC 180


8536R-1.IR full       181 TTATCAAAAGACAGAGAGCGGGACCAGGAGCTCAATGGCGGACCCAACTCTACCATAAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     181 TTATCAAAAGACAGAGAGCGGGACCAGGAGCTCAATGGCGGACCCAACTCTACCATAAGA 240


8536R-1.IR full       241 ACTGTGATTGCCACGGCAAACTTTACTTCCATTCCACAAGACTTAACGCGCTTCCTGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     241 ACTGTGATTGCCACGGCAAACTTTACTTCCATTCCACAAGACTTAACGCGCTTCCTGCTG 300


8536R-1.IR full       301 GGCACAAAGAAATTTTTGCCCCCGCGACAGAAATCCACATCCGCCCTCCTTGCCAACTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     301 GGCACAAAGAAATTTTTGCCCCCGCGACAGAAATCCACATCCGCCCTCCTTGCCAACTGC 360


8536R-1.IR full       361 ACTGATCCCGATCCCCGTGATGGTGGACCCATCACGCCCAACACGACACTGGAGTCACTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     361 ACTGATCCCGATCCCCGTGATGGTGGACCCATCACGCCCAACACGACACTGGAGTCACTG 420


8536R-1.IR full       421 GACGTTATTGAGGCGGAGCTTGGACCTCTTTTGCGCCCTGGTGGCGCCTTCGAGCCTGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8536R-1.in silico     421 GACGTTATTGAGGCGGAGCTTGGACCTCTTTTGCGCCCTGGTGGCGCCTTCGAGCCTGAA 480


8536R-1.IR full       481 AACTGCAATGCCCAGCATCA 500
                          ||||||||||||||||||||
8536R-1.in silico     481 AACTGCAATGCCCAGCATCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137102.2  beta4GalNAcTA CG8536-RA (beta4GalNAcTA), mRNA 
NM_058041.2  CG12467-RA (CG12467), mRNA 
NM_206607.1  CG3857-RA (CG3857), mRNA 
NM_167095.1  Smg1 CG32743-RA (Smg1), mRNA 
NM_168677.1  CG32164-RA (CG32164), mRNA 
NM_169947.1  SNF4/AMP-activated protein kinase gamma subunit CG17299-RF, transcript variant F (SNF4Agamma), mRNA 
NM_078509.2  deltex CG3929-RA (dx), mRNA 
NM_135680.1  CG14943-RA (CG14943), mRNA 
NM_137600.2  Odorant-binding protein 56d CG11218-RA (Obp56d), mRNA 
NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
NM_132562.1  CG12720-RA (CG12720), mRNA 
NM_078872.4  bicoid stability factor CG10302-RA (bsf), mRNA 
NM_057841.3  daughterless CG5102-RA (da), mRNA 
NM_078677.2  Transferrin 1 CG6186-RA (Tsf1), mRNA 
NM_132538.1  CG15737-RA (CG15737), mRNA 
NM_136069.2  CG10600-RA (CG10600), mRNA 
NM_206678.1  sprint CG33175-RA, transcript variant A (spri), mRNA 
NM_176723.2  sprint CG33175-RG, transcript variant G (spri), mRNA 
12  NM_134544.1  HERC2 CG11734-RB (HERC2), mRNA 
NM_142649.2  CG4000-RA (CG4000), mRNA 
NM_132302.3  dalao CG7055-RA (dalao), mRNA 
NM_078662.2  BarH2 CG5488-RA (B-H2), mRNA 
NM_080054.2  myospheroid CG1560-RA (mys), mRNA 
NM_057215.3  abrupt CG4807-RB, transcript variant B (ab), mRNA 
NM_057214.3  abrupt CG4807-RA, transcript variant A (ab), mRNA 
NM_132957.1  CG9059-RB, transcript variant B (CG9059), mRNA 
NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
NM_079757.3  nicotinic Acetylcholine Receptor alpha 96Aa CG5610-RA (nAcRalpha-96Aa), mRNA 
NM_165658.1  lightoid CG8024-RD, transcript variant D (ltd), mRNA 
NM_165659.1  lightoid CG8024-RC, transcript variant C (ltd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.