National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8533R-1 
 Symbol CG8533  Full Name CG8533 
 CG No CG8533  Old CG No CG8533 
 Synonyms CT24909, CG8533 
 Accession No (Link to NCBI) NM_140891.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGCAAGATGCGAAACCTCA 
 Primer Seq. 3'
aatctagaggtaccGCGACGGGTTATACCAAGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGCAAGAT GCGAAACCTC AAGGGACGCG AGGTAGTCAT AGGCATCTTC GACTACAAGC 
0061 CTTTTATGCT ATTGGATTAT GAAAAGCCAC CATTATATTA TGATCGTTTT ATGAACACGA 
0121 CGGATGTAAC CATTGATGGA ACAGATATTC AACTAATGCT CATTTTCTGC GAGTTGTACA 
0181 ACTGCACCAT TCAGGTGGAC ACATCTGAAC CATACGACTG GGGTGACATC TACTTGAATN 
0241 NCTCGGGCTA TGGTCTGGTT GGAATGATCC TCGATAGACG AAACGATTAC GGAGTAGGGG 
0301 GCATGTATTT GTGGTACGAG GCGTACGAGT ATATGGACAT GACTCATTTT CTGGGACGAT 
0361 CTGGAGTAAC CTGTCTGGTG CCCGCTCCGA ACCGTTTAAT CAgNTGGACG CTCCTGCTCC 
0421 GACCATTCCA GTTTGTcCTC TGGATGTGCG TGATGNTCTG CCTTCTGCTC GAGAGCTTAG 
0481 CTCTTGGTAT AACCCGNCNN  
 in silico PCR Fragment
0001 CCAGCAAGAT GCGAAACCTC AAGGGACGCG AGGTAGTCAT AGGCATCTTC GACTACAAGC 
0061 CTTTTATGCT ATTGGATTAT GAAAAGCCAC CATTATATTA TGATCGTTTT ATGAACACGA 
0121 CGGATGTAAC CATTGATGGA ACAGATATTC AACTAATGCT CATTTTCTGC GAGTTGTACA 
0181 ACTGCACCAT TCAGGTGGAC ACATCTGAAC CATACGACTG GGGTGACATC TACTTGAATG 
0241 CCTCGGGCTA TGGTCTGGTT GGAATGATCC TCGATAGACG AAACGATTAC GGAGTAGGGG 
0301 GCATGTATTT GTGGTACGAG GCGTACGAGT ATATGGACAT GACTCATTTT CTGGGACGAT 
0361 CTGGAGTAAC CTGTCTGGTG CCCGCTCCGA ACCGTTTAAT CAGCTGGACG CTCCTGCTCC 
0421 GACCATTCCA GTTTGTCCTC TGGATGTGCG TGATGCTCTG CCTTCTGCTC GAGAGCTTAG 
0481 CTCTTGGTAT AACCCGTCGC  
 Assemble Data

8533R-1.IR_full       1   CCAGCAAGATGCGAAACCTCAAGGGACGCGAGGTAGTCATAGGCATCTTCGACTACAAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8533R-1.in silico     1   CCAGCAAGATGCGAAACCTCAAGGGACGCGAGGTAGTCATAGGCATCTTCGACTACAAGC 60


8533R-1.IR_full       61  CTTTTATGCTATTGGATTATGAAAAGCCACCATTATATTATGATCGTTTTATGAACACGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8533R-1.in silico     61  CTTTTATGCTATTGGATTATGAAAAGCCACCATTATATTATGATCGTTTTATGAACACGA 120


8533R-1.IR_full       121 CGGATGTAACCATTGATGGAACAGATATTCAACTAATGCTCATTTTCTGCGAGTTGTACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8533R-1.in silico     121 CGGATGTAACCATTGATGGAACAGATATTCAACTAATGCTCATTTTCTGCGAGTTGTACA 180


8533R-1.IR_full       181 ACTGCACCATTCAGGTGGACACATCTGAACCATACGACTGGGGTGACATCTACTTGAATN 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
8533R-1.in silico     181 ACTGCACCATTCAGGTGGACACATCTGAACCATACGACTGGGGTGACATCTACTTGAATG 240


8533R-1.IR_full        241 CTCGGGCTATGGTCTGGTTGGAATGATCCTCGATAGACGAAACGATTACGGAGTAGGGG 299
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8533R-1.in silico      241 CTCGGGCTATGGTCTGGTTGGAATGATCCTCGATAGACGAAACGATTACGGAGTAGGGG 299


8533R-1.IR_full       301 GCATGTATTTGTGGTACGAGGCGTACGAGTATATGGACATGACTCATTTTCTGGGACGAT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8533R-1.in silico     301 GCATGTATTTGTGGTACGAGGCGTACGAGTATATGGACATGACTCATTTTCTGGGACGAT 359


8533R-1.IR_full       361 CTGGAGTAACCTGTCTGGTGCCCGCTCCGAACCGTTTAATCAGNTGGACGCTCCTGCTCC 419
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
8533R-1.in silico     361 CTGGAGTAACCTGTCTGGTGCCCGCTCCGAACCGTTTAATCAGCTGGACGCTCCTGCTCC 419


8533R-1.IR_full       421 GACCATTCCAGTTTGTCCTCTGGATGTGCGTGATGNTCTGCCTTCTGCTCGAGAGCTTAG 479
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
8533R-1.in silico     421 GACCATTCCAGTTTGTCCTCTGGATGTGCGTGATGCTCTGCCTTCTGCTCGAGAGCTTAG 479


8533R-1.IR_full       481 CTCTTGGTATAACCCGNCNN 499
                          |||||||||||||||| |  
8533R-1.in silico     481 CTCTTGGTATAACCCGTCGC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168817.1  CG8533-RB, transcript variant B (CG8533), mRNA 
100   482  NM_140891.1  CG8533-RA, transcript variant A (CG8533), mRNA 
100   482  NM_168818.1  CG8533-RC, transcript variant C (CG8533), mRNA 
0   NM_132445.1  CG1567-RA (C901), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_132823.1  CG15646-RA (CG15646), mRNA 
0   NM_057374.2  CG3722-RA (shg), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 
0   NM_134929.2  CG3254-RA (pgant2), mRNA 
0   NM_132096.3  CG3342-RA (CG3342), mRNA 
0   NM_170505.1  CG1539-RF, transcript variant F (tmod), mRNA 
0   NM_170506.1  CG1539-RC, transcript variant C (tmod), mRNA 
0   NM_057683.2  CG1539-RA, transcript variant A (tmod), mRNA 
0   NM_057684.2  CG1539-RB, transcript variant B (tmod), mRNA 
0   NM_170503.1  CG1539-RD, transcript variant D (tmod), mRNA 
0   NM_170504.1  CG1539-RE, transcript variant E (tmod), mRNA 
0   NM_080120.2  CG14560-RA (msopa), mRNA 
0   NM_143348.2  CG4849-RA (CG4849), mRNA 
0   NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   NM_166180.2  CG4905-RB, transcript variant B (Syn2), mRNA 
0   NM_166181.2  CG4905-RD, transcript variant D (Syn2), mRNA 
0   NM_166179.2  CG4905-RA, transcript variant A (Syn2), mRNA 
0   NM_079038.3  CG4905-RC, transcript variant C (Syn2), mRNA 
0   NM_176201.1  CG4905-RE, transcript variant E (Syn2), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001015387.1  CG40042-PA.3 (CG40042), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.