National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8501R-2 
 Symbol CG8501  Full Name CG8501 
 CG No CG8501  Old CG No CG8501 
 Synonyms CG8501 
 Accession No (Link to NCBI) NM_136927.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGGCAGCGGATCTGAGCTTCCACTACGGATCTGTATGGTCTGGCTGGTCGCGGGTCTG 60

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGATTGGCGA-GGCACTCCGGTGCTACGAGTGTGTCGATCAGGAGACGTCGTGCGGATC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCTGATAATTCGCCGGGAAGAGTGCGAGAATGCCCGAACTCAACCATGTGCTCGACCAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATGCTGACCACAATGGTGAATGGAAATGAGTGGATCAGGGTGAGGCGAGGCTGTGCCAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCAGGTGGATCATTACTTTGACTATATTGGAAAGCATTGGGAGCAGAAGTATCGACTGAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGACTTACCGGAGGGCTGCAAGAAGGAGAATGGAAGGATGAATTGCAACTGTCGCGGAGA 360

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACTTTGCAATTCAGGAAGTCATTCGACACCAAATTTCCGGTTGCCGTTCGTGCTGATCTT 420

                          ||||||||||||||||||||||||||||||| |||||| silico     421 ATTGGCCCTGGTCTGCGGCAAAATCCTTCTT-CCCGTC 458

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   438  NM_136927.2  CG8501-RA (CG8501), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
0   NM_138129.2  CG16896-RA (CG16896), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_057665.3  CG15444-RA, transcript variant A (ine), mRNA 
0   NM_175958.1  CG15444-RC, transcript variant C (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_139631.1  CG15012-RB (CG15012), mRNA 
0   NM_206006.2  CG10604-RB, transcript variant B (bsh), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_166134.2  CG8395-RA (Rrp42), mRNA 
0   NM_168885.1  CG10523-RC, transcript variant C (park), mRNA 
0   NM_168884.1  CG10523-RB, transcript variant B (park), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NM_141830.2  CG6790-RA (CG6790), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_140861.1  CG9451-RA (CG9451), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_141935.2  CG5663-RA (Dip-C), mRNA 
0   NM_001042870.1  CG34126-RB (CG34126), mRNA 
0   NM_135479.3  CG4594-RA (CG4594), mRNA 
0   NM_141257.1  CG12591-RA, transcript variant A (dpr16), mRNA 
0   NM_167232.1  CG2890-RA, transcript variant A (PPP4R2r), mRNA 
0   NM_206677.1  CG2890-RC, transcript variant C (PPP4R2r), mRNA 
0   NM_080344.2  CG2890-RB, transcript variant B (PPP4R2r), mRNA 
0   NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.