National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8501R-2 
 Symbol CG8501  Full Name CG8501 
 CG No CG8501  Old CG No CG8501 
 Synonyms CG8501 
 Accession No (Link to NCBI) NM_136927.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGCAGCGGATCTGAGCTT 
 Primer Seq. 3'
aatctagaggtaccGACGGGAAGAAGGATTTTGCC 
 Predicted Fragment Size
456 
 IR fragment full Seq
0001 ATGGGCAGCG GATCTGAGCT TCCACTACGG ATCTGTATGG TCTGGCTGGT CGCGGGTCTG 
0061 GCGATTGGCG ANGGCACTCC GGTGCTACGA GTGTGTCGAT CAGGAGACGT CGTGCGGATC 
0121 TGCTGATAAT TCGCCGGGAA GAGTGCGAGA ATGCCCGAAC TCAACCATGT GCTCGACCAC 
0181 CATGCTGACC ACAATGGTGA ATGGAAATGA GTGGATCAGG GTGAGGCGAG GCTGTGCCAA 
0241 GCAGGTGGAT CATTACTTTG ACTATATTGG AAAGCATTGG GAGCAGAAGT ATCGACTGAT 
0301 GGACTTACCG GAGGGCTGCA AGAAGGAGAA TGGAAGGATG AATTGCAACT GTCGCGGAGA 
0361 ACTGTGCAAT TCAGGAAGTC ATTCGACACC AAATTTCCGG TTGCCGTTCG TGCTGATCTT 
0421 ATTGGCCCTG GTCTGCGGCA AAATCCTTCT TCCCCGTC 
 in silico PCR Fragment
0001 ATGGGCAGCG GATCTGAGCT TCCACTACGG ATCTGTATGG TCTGGCTGGT CGCGGGTCTG 
0061 GCGATTGGCG A-GGCACTCC GGTGCTACGA GTGTGTCGAT CAGGAGACGT CGTGCGGATC 
0121 TGCTGATAAT TCGCCGGGAA GAGTGCGAGA ATGCCCGAAC TCAACCATGT GCTCGACCAC 
0181 CATGCTGACC ACAATGGTGA ATGGAAATGA GTGGATCAGG GTGAGGCGAG GCTGTGCCAA 
0241 GCAGGTGGAT CATTACTTTG ACTATATTGG AAAGCATTGG GAGCAGAAGT ATCGACTGAT 
0301 GGACTTACCG GAGGGCTGCA AGAAGGAGAA TGGAAGGATG AATTGCAACT GTCGCGGAGA 
0361 ACTTTGCAAT TCAGGAAGTC ATTCGACACC AAATTTCCGG TTGCCGTTCG TGCTGATCTT 
0421 ATTGGCCCTG GTCTGCGGCA AAATCCTTCT T-CCCGTC 
 Assemble Data

8501R-2.IR_full       1   ATGGGCAGCGGATCTGAGCTTCCACTACGGATCTGTATGGTCTGGCTGGTCGCGGGTCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     1   ATGGGCAGCGGATCTGAGCTTCCACTACGGATCTGTATGGTCTGGCTGGTCGCGGGTCTG 60


8501R-2.IR_full       61  GCGATTGGCGANGGCACTCCGGTGCTACGAGTGTGTCGATCAGGAGACGTCGTGCGGATC 120
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     61  GCGATTGGCGA-GGCACTCCGGTGCTACGAGTGTGTCGATCAGGAGACGTCGTGCGGATC 120


8501R-2.IR_full       121 TGCTGATAATTCGCCGGGAAGAGTGCGAGAATGCCCGAACTCAACCATGTGCTCGACCAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     121 TGCTGATAATTCGCCGGGAAGAGTGCGAGAATGCCCGAACTCAACCATGTGCTCGACCAC 180


8501R-2.IR_full       181 CATGCTGACCACAATGGTGAATGGAAATGAGTGGATCAGGGTGAGGCGAGGCTGTGCCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     181 CATGCTGACCACAATGGTGAATGGAAATGAGTGGATCAGGGTGAGGCGAGGCTGTGCCAA 240


8501R-2.IR_full       241 GCAGGTGGATCATTACTTTGACTATATTGGAAAGCATTGGGAGCAGAAGTATCGACTGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     241 GCAGGTGGATCATTACTTTGACTATATTGGAAAGCATTGGGAGCAGAAGTATCGACTGAT 300


8501R-2.IR_full       301 GGACTTACCGGAGGGCTGCAAGAAGGAGAATGGAAGGATGAATTGCAACTGTCGCGGAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     301 GGACTTACCGGAGGGCTGCAAGAAGGAGAATGGAAGGATGAATTGCAACTGTCGCGGAGA 360


8501R-2.IR_full       361 ACTGTGCAATTCAGGAAGTCATTCGACACCAAATTTCCGGTTGCCGTTCGTGCTGATCTT 420
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8501R-2.in silico     361 ACTTTGCAATTCAGGAAGTCATTCGACACCAAATTTCCGGTTGCCGTTCGTGCTGATCTT 420


8501R-2.IR_full       421 ATTGGCCCTGGTCTGCGGCAAAATCCTTCTTCCCCGTC 458
                          ||||||||||||||||||||||||||||||| ||||||
8501R-2.in silico     421 ATTGGCCCTGGTCTGCGGCAAAATCCTTCTT-CCCGTC 458

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   438  NM_136927.2  CG8501-RA (CG8501), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
0   NM_138129.2  CG16896-RA (CG16896), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_057665.3  CG15444-RA, transcript variant A (ine), mRNA 
0   NM_175958.1  CG15444-RC, transcript variant C (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_139631.1  CG15012-RB (CG15012), mRNA 
0   NM_206006.2  CG10604-RB, transcript variant B (bsh), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_166134.2  CG8395-RA (Rrp42), mRNA 
0   NM_168885.1  CG10523-RC, transcript variant C (park), mRNA 
0   NM_168884.1  CG10523-RB, transcript variant B (park), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NM_141830.2  CG6790-RA (CG6790), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_140861.1  CG9451-RA (CG9451), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_141935.2  CG5663-RA (Dip-C), mRNA 
0   NM_001042870.1  CG34126-RB (CG34126), mRNA 
0   NM_135479.3  CG4594-RA (CG4594), mRNA 
0   NM_141257.1  CG12591-RA, transcript variant A (dpr16), mRNA 
0   NM_167232.1  CG2890-RA, transcript variant A (PPP4R2r), mRNA 
0   NM_206677.1  CG2890-RC, transcript variant C (PPP4R2r), mRNA 
0   NM_080344.2  CG2890-RB, transcript variant B (PPP4R2r), mRNA 
0   NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.