National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8431R-2 
 Symbol Aats-cys  Full Name Cysteinyl-tRNA synthetase 
 CG No CG8431  Old CG No CG8431 
 Synonyms CG8431, CysRS, CRS, BcDNA:LD21177, Aats-cys 
 Accession No (Link to NCBI) NM_137243.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCGAAACGTGGGCAACCG 
 Primer Seq. 3'
aatctagaggtaccTCACCCTTGCCAACGGCCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCGAAAC GTGGGCAACC GGCGTGGGCA AGCTCCCGAG GCGGTGGATC GGCCGAAACT 
0061 GAAAGCTGTT CAACAGCCTG ACGCGACAGA AGGAGGACTT CGTGCCGCTG GACGGGAATA 
0121 ATGTAACGTG GTATAGCTGC GGACCCACCG TCTACGATGC CTCACACATG GGGCATGCTA 
0181 GATCTTACAT TTCCTTCGAC ATTCTGCGGC GCATTCTGTC CGACTACTTT GGCTACAACA 
0241 TTCACTATGT GATGAACATT ACGGACATCG ACGACAAGAT CATAAGGCGT GCGCGGCAGA 
0301 ATCATCTTTT CGACGAGTAC GCTGCTGAGG CGCAAAAGCT GCCACTGGAT GAGCTGCTGG 
0361 GTCAGCAAAA GGAGGTACTG CAGCGGTTTC AGGATACATG CGCCAAGAAT ACAGATCCCG 
0421 ACAAGAAGAT TATGCTCGAC AAGACACTGC AGCGGATGAA CGATGCTGTG GAGGCGCTGA 
0481 CCAAGGCCGT TGGCAAGGGT GA 
 in silico PCR Fragment
0001 ATGTCGAAAC GTGGGCAACC GGCGT-GGCA AGCTCCCGAG GCGGTGGATC GGCCGAAACT 
0061 G-AAGCTGTT CAACAGCCTG ACGCGACAGA AGGAGGACTT CGTGCCGCTG GACGGCAATA 
0121 ATGTAACGTG GTATAGCTGC GGACCCACCG TCTACGATGC CTCACACATG GGGCATGCTA 
0181 GATCTTACAT TTCCTTCGAC ATTCTGCGGC GCATTCTGTC CGACTACTTT GGCTACAACA 
0241 TTCACTATGT GATGAACATT ACGGACATCG ACGACAAGAT CATAAGGCGT GCGCGGCAGA 
0301 ATCATCTCTT CGACGAGTAC GCTGCTGAGG CGCAAAAGCT GCCACTGGAT GAGCTGCTGG 
0361 GTCAGCAAAA GGAGGTACTG CAGCGGTTTC AGGATACATG CGCCAAGAAT ACAGATCCCG 
0421 ACAAGAAGAT TATGCTCGAC AAGACACTGC AGCGGATGAA CGATGCTGTG GAGGCGCTGA 
0481 CCAAGGCCGT TGGCAAGGGT GA 
 Assemble Data

8431R-2.IR_full       1   ATGTCGAAACGTGGGCAACCGGCGTGGGCAAGCTCCCGAGGCGGTGGATCGGCCGAAACT 60
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
8431R-2.in silico     1   ATGTCGAAACGTGGGCAACCGGCGT-GGCAAGCTCCCGAGGCGGTGGATCGGCCGAAACT 60


8431R-2.IR_full       61  GAAAGCTGTTCAACAGCCTGACGCGACAGAAGGAGGACTTCGTGCCGCTGGACGGGAATA 120
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
8431R-2.in silico     61  G-AAGCTGTTCAACAGCCTGACGCGACAGAAGGAGGACTTCGTGCCGCTGGACGGCAATA 120


8431R-2.IR_full       121 ATGTAACGTGGTATAGCTGCGGACCCACCGTCTACGATGCCTCACACATGGGGCATGCTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8431R-2.in silico     121 ATGTAACGTGGTATAGCTGCGGACCCACCGTCTACGATGCCTCACACATGGGGCATGCTA 180


8431R-2.IR_full       181 GATCTTACATTTCCTTCGACATTCTGCGGCGCATTCTGTCCGACTACTTTGGCTACAACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8431R-2.in silico     181 GATCTTACATTTCCTTCGACATTCTGCGGCGCATTCTGTCCGACTACTTTGGCTACAACA 240


8431R-2.IR_full       241 TTCACTATGTGATGAACATTACGGACATCGACGACAAGATCATAAGGCGTGCGCGGCAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8431R-2.in silico     241 TTCACTATGTGATGAACATTACGGACATCGACGACAAGATCATAAGGCGTGCGCGGCAGA 300


8431R-2.IR_full       301 ATCATCTTTTCGACGAGTACGCTGCTGAGGCGCAAAAGCTGCCACTGGATGAGCTGCTGG 360
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
8431R-2.in silico     301 ATCATCTCTTCGACGAGTACGCTGCTGAGGCGCAAAAGCTGCCACTGGATGAGCTGCTGG 360


8431R-2.IR_full       361 GTCAGCAAAAGGAGGTACTGCAGCGGTTTCAGGATACATGCGCCAAGAATACAGATCCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8431R-2.in silico     361 GTCAGCAAAAGGAGGTACTGCAGCGGTTTCAGGATACATGCGCCAAGAATACAGATCCCG 420


8431R-2.IR_full       421 ACAAGAAGATTATGCTCGACAAGACACTGCAGCGGATGAACGATGCTGTGGAGGCGCTGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8431R-2.in silico     421 ACAAGAAGATTATGCTCGACAAGACACTGCAGCGGATGAACGATGCTGTGGAGGCGCTGA 480


8431R-2.IR_full       481 CCAAGGCCGTTGGCAAGGGTGA 502
                          ||||||||||||||||||||||
8431R-2.in silico     481 CCAAGGCCGTTGGCAAGGGTGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137243.2  CG8431-RA (Aats-cys), mRNA 
0   NM_166745.1  CG31999-RA (CG31999), mRNA 
0   10  NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_143665.2  CG2041-RA (lgs), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_135259.2  CG4502-RA, transcript variant A (CG4502), mRNA 
0   NM_164741.1  CG4502-RB, transcript variant B (CG4502), mRNA 
0   NM_167060.1  CG32750-RA (CG32750), mRNA 
0   NM_206696.1  CG1522-RC, transcript variant C (cac), mRNA 
0   NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 
0   NM_206694.1  CG1522-RE, transcript variant E (cac), mRNA 
0   NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_206697.1  CG1522-RB, transcript variant B (cac), mRNA 
0   NM_168563.1  CG32137-RB, transcript variant B (CG32137), mRNA 
0   NM_168564.1  CG32137-RA, transcript variant A (CG32137), mRNA 
0   NM_132202.2  CG15330-RA (CG15330), mRNA 
0   NM_078827.1  CG4977-RA (kek2), mRNA 
0   15  16  NM_167065.1  CG32744-RA (CG32744), mRNA 
0   NM_130724.2  CG2934-RA (VhaAC39), mRNA 
0   10  NM_132078.1  CG11700-RA (CG11700), mRNA 
0   NM_140627.2  CG4784-RA (CG4784), mRNA 
0   NM_136845.1  CG9003-RA (CG9003), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.