National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8431R-1 
 Symbol Aats-cys  Full Name Cysteinyl-tRNA synthetase 
 CG No CG8431  Old CG No CG8431 
 Synonyms CG8431, CysRS, CRS, BcDNA:LD21177, Aats-cys 
 Accession No (Link to NCBI) NM_137243.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     1   ATGTCGAAACGTGGGCAACCGGCGT-GGCAAGCTCCCGAGGCGGTGGATCGGCCGAAACT 60

                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     61  G-AAGCTGTTCAACAGCCTGACGCGACAGAAGGAGGACTTCGTGCCGCTGGACGGCAATA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGTAACGTGGTATAGCTGCGGACCCACCGTCTACGATGCCTCACACATGGGGCATGCTA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GATCTTACATTTCCTTCGACATTCTGCGGCGCATTCTGTCCGACTACTTTGGCTACAACA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTCACTATGTGATGAACATTACGGACATCGACGACAAGATCATAAGGCGTGCGCGGCAGA 300

                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATCATCTCTTCGACGAGTACGCTGCTGAGGCGCAAAAGCTGCCACTGGATGAGCTGCTGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTCAGCAAAAGGAGGTACTGCAGCGGTTTCAGGATACATGCGCCAAGAATACAGATCCCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAAGAAGATTATGCTCGACAAGACACTGCAGCGGATGAACGATGCTGTGGAGGCGCTGA 480

8431R-1.IR_full       481 CCAAGGCCGTTGGCAAGGGTGA 502
                          |||||||||||||||||||||| silico     481 CCAAGGCCGTTGGCAAGGGTGA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137243.2  CG8431-RA (Aats-cys), mRNA 
0   NM_166745.1  CG31999-RA (CG31999), mRNA 
0   10  NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_143665.2  CG2041-RA (lgs), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_135259.2  CG4502-RA, transcript variant A (CG4502), mRNA 
0   NM_164741.1  CG4502-RB, transcript variant B (CG4502), mRNA 
0   NM_167060.1  CG32750-RA (CG32750), mRNA 
0   NM_206696.1  CG1522-RC, transcript variant C (cac), mRNA 
0   NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 
0   NM_206694.1  CG1522-RE, transcript variant E (cac), mRNA 
0   NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_206697.1  CG1522-RB, transcript variant B (cac), mRNA 
0   NM_168563.1  CG32137-RB, transcript variant B (CG32137), mRNA 
0   NM_168564.1  CG32137-RA, transcript variant A (CG32137), mRNA 
0   NM_132202.2  CG15330-RA (CG15330), mRNA 
0   NM_078827.1  CG4977-RA (kek2), mRNA 
0   15  16  NM_167065.1  CG32744-RA (CG32744), mRNA 
0   NM_130724.2  CG2934-RA (VhaAC39), mRNA 
0   10  NM_132078.1  CG11700-RA (CG11700), mRNA 
0   NM_140627.2  CG4784-RA (CG4784), mRNA 
0   NM_136845.1  CG9003-RA (CG9003), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.