National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8428R-4 
 Symbol spin  Full Name spinster 
 CG No CG8428  Old CG No CG8428 
 Synonyms bnch, CG8428, Spin, l(2)k09905, l(2)10403, spin, 25/11, l(2)k02511, l(2R)W5, l(2)W5 
 Accession No (Link to NCBI) NM_166145.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCGCTGAAACACCAGAAG 
 Primer Seq. 3'
aatctagaggtaccGCGCATACCATGTACGAGATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCGCTGA AACACCAGAA GCAATCCTAC CAACCGCTCC CAACgGCGGC CGcCATGGAC 
0061 AATCCGGCGA TGATCCAGAG CAGCGGTAGC AGTNGGGAGC AGCTCCTCTG AGGAGGGCGG 
0121 GAGTCGTGAG GATGTGGCCA ATCTATCGCC GCTCGGACTG CCTACGACCT ACTCGTCACA 
0181 GCAATTGATG CCCTCGGATA CGGACAGCAT GGAGGAGGAG CGGCACCGAC TGCGTCCCCA 
0241 CCACCATCNC CACCACCCAC TGGGCGAGCA CCACCACATC CCGGGCATAC CACCATCCGC 
0301 CGTCGTGCCA TCGCGTCTCT CCAGCGTGGG CAGATCGCAG TGGTTCACCG TTACCGTGCT 
0361 ATGCTNTCGT CAACCTCATC AACTACATGG ATCGCTTTAC GATCGCAGGA GTTCTCACAG 
0421 ATGTCCGAAA TGATTTCGAT ATTGGCAATG ATAGTGCCGG ACTTCTCCAG ACGGTCTTCG 
0481 TTATCTCGTA CATGGTATNG CGC 
 in silico PCR Fragment
0001 ATGTCGCTGA AACACCAGAA GCAATCCTAC CAACCGCTCC CAACGGCGGC CGCCATGGAC 
0061 AATCCGGCGA TGATCCAGAG CAGCGGTAGC AGT-GGGAGC AGCTCCTCTG AGGAGGGCGG 
0121 GAGTCGTGAG GATGTGGCCA ATCTATCGCC GCTCGGACTG CCTACGACCT ACTCGTCACA 
0181 GCAATTGATG CCCTCGGATA CGGACAGCAT GGAGGAGGAG CGGCACCGAC TGCGTCCCCA 
0241 CCACCATCAC CACCACCCAC TGGGCGAGCA CCACCACATC CCGGGCATAC CACCATCCGC 
0301 CGTCGTGCCA TCGCGTCTCT CCAGCGTGGG CAGATCGCAG TGGTTCACCG TTACCGTGCT 
0361 ATGCT-TCGT CAACCTCATC AACTACATGG ATCGCTTTAC GATCGCAGGA GTTCTCACAG 
0421 ATGTCCGAAA TGATTTCGAT ATTGGCAATG ATAGTGCCGG ACTTCTCCAG ACGGTCTTCG 
0481 TTATCTCGTA CATGGTAT-G CGC 
 Assemble Data

8428R-4.IR_full       1   ATGTCGCTGAAACACCAGAAGCAATCCTACCAACCGCTCCCAACGGCGGCCGCCATGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     1   ATGTCGCTGAAACACCAGAAGCAATCCTACCAACCGCTCCCAACGGCGGCCGCCATGGAC 60


8428R-4.IR_full       61  AATCCGGCGATGATCCAGAGCAGCGGTAGCAGTNGGGAGCAGCTCCTCTGAGGAGGGCGG 120
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
8428R-4.in silico     61  AATCCGGCGATGATCCAGAGCAGCGGTAGCAGT-GGGAGCAGCTCCTCTGAGGAGGGCGG 120


8428R-4.IR_full       121 GAGTCGTGAGGATGTGGCCAATCTATCGCCGCTCGGACTGCCTACGACCTACTCGTCACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     121 GAGTCGTGAGGATGTGGCCAATCTATCGCCGCTCGGACTGCCTACGACCTACTCGTCACA 180


8428R-4.IR_full       181 GCAATTGATGCCCTCGGATACGGACAGCATGGAGGAGGAGCGGCACCGACTGCGTCCCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     181 GCAATTGATGCCCTCGGATACGGACAGCATGGAGGAGGAGCGGCACCGACTGCGTCCCCA 240


8428R-4.IR_full       241 CCACCATCNCCACCACCCACTGGGCGAGCACCACCACATCCCGGGCATACCACCATCCGC 300
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     241 CCACCATCACCACCACCCACTGGGCGAGCACCACCACATCCCGGGCATACCACCATCCGC 300


8428R-4.IR_full       301 CGTCGTGCCATCGCGTCTCTCCAGCGTGGGCAGATCGCAGTGGTTCACCGTTACCGTGCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     301 CGTCGTGCCATCGCGTCTCTCCAGCGTGGGCAGATCGCAGTGGTTCACCGTTACCGTGCT 360


8428R-4.IR_full       361 ATGCTNTCGTCAACCTCATCAACTACATGGATCGCTTTACGATCGCAGGAGTTCTCACAG 420
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     361 ATGCT-TCGTCAACCTCATCAACTACATGGATCGCTTTACGATCGCAGGAGTTCTCACAG 420


8428R-4.IR_full       421 ATGTCCGAAATGATTTCGATATTGGCAATGATAGTGCCGGACTTCTCCAGACGGTCTTCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8428R-4.in silico     421 ATGTCCGAAATGATTTCGATATTGGCAATGATAGTGCCGGACTTCTCCAGACGGTCTTCG 480


8428R-4.IR_full       481 TTATCTCGTACATGGTATNGCGC 503
                          |||||||||||||||||| ||||
8428R-4.in silico     481 TTATCTCGTACATGGTAT-GCGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
100   482  NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
100   482  NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
100   482  NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
100   482  NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0.62   10  NM_141046.3  CG7605-RA (Rab26), mRNA 
0.41   13  27  NM_079322.2  CG10605-RA (caup), mRNA 
0.41   11  NM_001031953.1  CG6128-RA, transcript variant A (CG6128), mRNA 
0.41   11  NM_001031952.1  CG11714-RA, transcript variant A (CG11714), mRNA 
0.41   13  33  NM_136646.1  CG13953-RA (CG13953), mRNA 
0.41   25  NM_136533.1  CG11641-RA (pdm3), mRNA 
0.41   14  NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0.41   14  NM_169403.1  CG6791-RA, transcript variant A (CG6791), mRNA 
0.41   14  NM_141833.2  CG6791-RB, transcript variant B (CG6791), mRNA 
0.41   13  NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0.41   13  NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0.2   10  12  NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0.2   10  12  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0.2   NM_130617.2  CG4281-RA (CG4281), mRNA 
0.2   14  NM_079109.2  CG5575-RA (ken), mRNA 
0.2   12  NM_079180.2  CG10579-RD, transcript variant D (Eip63E), mRNA 
0.2   12  NM_168033.1  CG10579-RE, transcript variant E (Eip63E), mRNA 
0.2   12  NM_001043116.1  CG10579-RF, transcript variant F (Eip63E), mRNA 
0.2   11  NM_168035.1  CG10579-RB, transcript variant B (Eip63E), mRNA 
0.2   11  NM_001043121.1  CG10579-RJ, transcript variant J (Eip63E), mRNA 
0.2   11  NM_001043117.1  CG10579-RH, transcript variant H (Eip63E), mRNA 
0.2   11  NM_001043120.1  CG10579-RG, transcript variant G (Eip63E), mRNA 
0.2   11  NM_168036.1  CG10579-RC, transcript variant C (Eip63E), mRNA 
0.2   11  NM_168034.1  CG10579-RA, transcript variant A (Eip63E), mRNA 
0.2   11  NM_001043119.1  CG10579-RI, transcript variant I (Eip63E), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.