National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8336R-3 
 Symbol CG8336  Full Name CG8336 
 CG No CG8336  Old CG No CG8336 
 Synonyms CG8336 
 Accession No (Link to NCBI) NM_140081.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGGATGCGGGTCGAATGA 
 Primer Seq. 3'
aatctagaggtaccGATGCCCCAGTCCTCGTTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGGATGC GGGTCGAATG ATAANTTGAA CTGCGCAAGG ATGTTGTGCC GAAGACAGCG 
0061 GAAAATTTCC GTGCCCTGTG CACGGGCGAA TGTGGTATCG GTACTCTGGG CAAANCCGCT 
0121 CCACTACAAG GGCACAAAGT TCCACAAGAT CAAGCGAGTC TTCGTCGTCC AGAGTGGGGA 
0181 TGTGGTGAAG AACGATGGAA GCAGCGGCGA GAGCATNCCT ACGGACCAGT TTTCGATGAC 
0241 GAGAACTTCG AACTCTCACA CAACGAAGAG GGCGTGGTCA GCATGGCCAA CTACGGCAAG 
0301 CCAAACTCCA ACAACTCGCA GTTTTTCATT TCCGCCGCGG GCTGTGAAAA TCTGAATGGA 
0361 ACAAACGTAG TCTGTAGGTC GTGTTTTACG CGGCTTGGGT ATCGTAGCTG AAATGGAACA 
0421 AAACTGCACT GACGAGGGCG ATCCCACGGC GCCGATCGTG ATACGGGACT GCGGAGAGAT 
0481 AGCTCACAAC GAGGACTGGG GCATC 
 in silico PCR Fragment
0001 AGGAGGATGC GGGTCGAATG ATAA-TTGAA CTGCGCAAGG ATGTTGTGCC GAAGACAGCG 
0061 GAAAATTTCC GTGCCCTGTG CACGGGCGAA TGTGGTATCG GTACTCTGGG CAAA-CCGCT 
0121 CCACTACAAG GGCACAAAGT TCCACAAGAT CAAGCGAGTC TTCGTCGTCC AGAGTGGGGA 
0181 TGTGGTGAAG AACGATGGAA GCAGCGGCGA GAGCAT--CT ACGGACCAGT TTTCGATGAC 
0241 GAGAACTTCG AACTCTCACA CAACGAAGAG GGCGTGGTCA GCATGGCCAA CTACGGCAAG 
0301 CCAAACTCCA ACAACTCGCA GTTTTTCATT TCCGCCGCGG GCTGTGAAAA TCTGAATGGA 
0361 ACAAACGTAG TC-GTAGGTC GTGTTTTACG CGGCCTGGGT ATCGTAGCTG AAATGGAACA 
0421 AAACTGCACT GACGAGGGCG ATCCCACGGC GCCGATCGTG ATACGGGACT GCGGAGAGAT 
0481 AGCTCACAAC GAGGACTGGG GCATC 
 Assemble Data

8336R-3.IR_full       1   AGGAGGATGCGGGTCGAATGATAANTTGAACTGCGCAAGGATGTTGTGCCGAAGACAGCG 60
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
8336R-3.in silico     1   AGGAGGATGCGGGTCGAATGATAA-TTGAACTGCGCAAGGATGTTGTGCCGAAGACAGCG 60


8336R-3.IR_full       61  GAAAATTTCCGTGCCCTGTGCACGGGCGAATGTGGTATCGGTACTCTGGGCAAANCCGCT 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
8336R-3.in silico     61  GAAAATTTCCGTGCCCTGTGCACGGGCGAATGTGGTATCGGTACTCTGGGCAAA-CCGCT 120


8336R-3.IR_full       121 CCACTACAAGGGCACAAAGTTCCACAAGATCAAGCGAGTCTTCGTCGTCCAGAGTGGGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8336R-3.in silico     121 CCACTACAAGGGCACAAAGTTCCACAAGATCAAGCGAGTCTTCGTCGTCCAGAGTGGGGA 180


8336R-3.IR_full       181 TGTGGTGAAGAACGATGGAAGCAGCGGCGAGAGCATNCCTACGGACCAGTTTTCGATGAC 240
                          ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
8336R-3.in silico     181 TGTGGTGAAGAACGATGGAAGCAGCGGCGAGAGCAT--CTACGGACCAGTTTTCGATGAC 240


8336R-3.IR_full       241 GAGAACTTCGAACTCTCACACAACGAAGAGGGCGTGGTCAGCATGGCCAACTACGGCAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8336R-3.in silico     241 GAGAACTTCGAACTCTCACACAACGAAGAGGGCGTGGTCAGCATGGCCAACTACGGCAAG 300


8336R-3.IR_full       301 CCAAACTCCAACAACTCGCAGTTTTTCATTTCCGCCGCGGGCTGTGAAAATCTGAATGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8336R-3.in silico     301 CCAAACTCCAACAACTCGCAGTTTTTCATTTCCGCCGCGGGCTGTGAAAATCTGAATGGA 360


8336R-3.IR_full       361 ACAAACGTAGTCTGTAGGTCGTGTTTTACGCGGCTTGGGTATCGTAGCTGAAATGGAACA 420
                          |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||
8336R-3.in silico     361 ACAAACGTAGTC-GTAGGTCGTGTTTTACGCGGCCTGGGTATCGTAGCTGAAATGGAACA 420


8336R-3.IR_full       421 AAACTGCACTGACGAGGGCGATCCCACGGCGCCGATCGTGATACGGGACTGCGGAGAGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8336R-3.in silico     421 AAACTGCACTGACGAGGGCGATCCCACGGCGCCGATCGTGATACGGGACTGCGGAGAGAT 480


8336R-3.IR_full       481 AGCTCACAACGAGGACTGGGGCATC 505
                          |||||||||||||||||||||||||
8336R-3.in silico     481 AGCTCACAACGAGGACTGGGGCATC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168355.1  CG8336-RC, transcript variant C (CG8336), mRNA 
100   482  NM_168354.1  CG8336-RB, transcript variant B (CG8336), mRNA 
100   482  NM_140081.2  CG8336-RA, transcript variant A (CG8336), mRNA 
0   NM_057489.3  CG4722-RA (bib), mRNA 
0   NM_142371.1  CG14330-RA (CG14330), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_142461.2  CG14309-RA (CG14309), mRNA 
0   NM_001043266.1  CG34119-RA (CG34119), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_138259.2  CG9165-RA (l(3)02640), mRNA 
0   NM_135745.1  CG5787-RA (CG5787), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   30  NM_140440.2  CG7768-RB, transcript variant B (CG7768), mRNA 
0   30  NM_168584.1  CG7768-RA, transcript variant A (CG7768), mRNA 
0   NM_079049.2  CG4886-RA (cyp33), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_135893.1  CG4103-RA (CG4103), mRNA 
0   NM_137851.2  CG2852-RA, transcript variant A (CG2852), mRNA 
0   NM_166539.1  CG2852-RB, transcript variant B (CG2852), mRNA 
0   NM_139945.2  CG13671-RA (CG13671), mRNA 
0   NM_143265.1  CG17192-RA (CG17192), mRNA 
0   NM_170400.1  CG31044-RA (CG31044), mRNA 
0   NM_176468.1  CG3359-RD, transcript variant D (mfas), mRNA 
0   NM_176475.1  CG3359-RF, transcript variant F (mfas), mRNA 
0   NM_176307.1  CG33162-RA (SrpRbeta), mRNA 
0   NM_143294.1  CG14260-RA (CG14260), mRNA 
0   NM_080136.1  CG18104-RA (arg), mRNA 
0   27  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.