National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8336R-1 
 Symbol CG8336  Full Name CG8336 
 CG No CG8336  Old CG No CG8336 
 Synonyms CG8336 
 Accession No (Link to NCBI) NM_140081.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     1   AGGAGGATGCGGGTCGAATGATAA-TTGAACTGCGCAAGGATGTTGTGCCGAAGACAGCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     61  GAAAATTTCCGTGCCCTGTGCACGGGCGAATGTGGTATCGGTACTCTGGGCAAA-CCGCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCACTACAAGGGCACAAAGTTCCACAAGATCAAGCGAGTCTTCGTCGTCCAGAGTGGGGA 180

                          ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| silico     181 TGTGGTGAAGAACGATGGAAGCAGCGGCGAGAGCAT--CTACGGACCAGTTTTCGATGAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAGAACTTCGAACTCTCACACAACGAAGAGGGCGTGGTCAGCATGGCCAACTACGGCAAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCAAACTCCAACAACTCGCAGTTTTTCATTTCCGCCGCGGGCTGTGAAAATCTGAATGGA 360

                          |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| silico     361 ACAAACGTAGTC-GTAGGTCGTGTTTTACGCGGCCTGGGTATCGTAGCTGAAATGGAACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAACTGCACTGACGAGGGCGATCCCACGGCGCCGATCGTGATACGGGACTGCGGAGAGAT 480

                          ||||||||||||||||||||||||| silico     481 AGCTCACAACGAGGACTGGGGCATC 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168355.1  CG8336-RC, transcript variant C (CG8336), mRNA 
100   482  NM_168354.1  CG8336-RB, transcript variant B (CG8336), mRNA 
100   482  NM_140081.2  CG8336-RA, transcript variant A (CG8336), mRNA 
0   NM_057489.3  CG4722-RA (bib), mRNA 
0   NM_142371.1  CG14330-RA (CG14330), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_142461.2  CG14309-RA (CG14309), mRNA 
0   NM_001043266.1  CG34119-RA (CG34119), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_138259.2  CG9165-RA (l(3)02640), mRNA 
0   NM_135745.1  CG5787-RA (CG5787), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   30  NM_140440.2  CG7768-RB, transcript variant B (CG7768), mRNA 
0   30  NM_168584.1  CG7768-RA, transcript variant A (CG7768), mRNA 
0   NM_079049.2  CG4886-RA (cyp33), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_135893.1  CG4103-RA (CG4103), mRNA 
0   NM_137851.2  CG2852-RA, transcript variant A (CG2852), mRNA 
0   NM_166539.1  CG2852-RB, transcript variant B (CG2852), mRNA 
0   NM_139945.2  CG13671-RA (CG13671), mRNA 
0   NM_143265.1  CG17192-RA (CG17192), mRNA 
0   NM_170400.1  CG31044-RA (CG31044), mRNA 
0   NM_176468.1  CG3359-RD, transcript variant D (mfas), mRNA 
0   NM_176475.1  CG3359-RF, transcript variant F (mfas), mRNA 
0   NM_176307.1  CG33162-RA (SrpRbeta), mRNA 
0   NM_143294.1  CG14260-RA (CG14260), mRNA 
0   NM_080136.1  CG18104-RA (arg), mRNA 
0   27  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.