National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8329R-3 
 Symbol CG8329  Full Name CG8329 
 CG No CG8329  Old CG No CG8329 
 Synonyms SP170, CG8329 
 Accession No (Link to NCBI) NM_140082.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTTGTTGCCACTGTCTGTGC 
 Primer Seq. 3'
aatctagaggtaccTCCATGCATTGCAGCCAGTCG 
 Predicted Fragment Size
492 
 IR fragment full Seq
0001 NTTTGTTGCC ACTGTCTGTG CCCACAGGAA TCGCAATCGT ACGGCTCATC ATGGTGGTGG 
0061 TCCCAAGGAC ATCATTGTAA ATGGCTATCC AGCCTACGAA GGCAAGGCAC CATATGCTGT 
0121 GGGCCTGCGA ATGAACAATG GAGCCGTGGG CGGAGGTTCC GTAATTGGAA ACAATTGGGT 
0181 CCTGACCGCT GCCCATTGCC TGACCACCGA TTCCGTGACC ATACACTACG GCTCGAATCG 
0241 TGCCTGGAAC GGTCAGCTTC AGCATACGGT GAACAAGAAT AACTTCTTTC GCCATCCAGG 
0301 ATATCCCAAT AGCGCTGGTC ACGACATCGG ACTCATTCGC ACCCCGTACG TCAGCTTCAC 
0361 CAATCTGATC AACAAAGTTT CGCTGCCCAA GTTCAGCCAA AAAGGTGAGC GTTTCGAGAA 
0421 CTGGTGGTGC gtGNCCTGCG GCTGGGGAGG AATGGCCAAT GGAGGATTgG CCGACTGGCT 
0481 GCAATGCATG GA 
 in silico PCR Fragment
0001 GTTTGTTGCC ACTGTCTGTG CCCACAGGAA TCGCAATCGT ACGGCTCATC ATGGTGGTGG 
0061 TCCCAAGGAC ATCATTGTAA ATGGCTATCC AGCCTACGAA GGCAAGGCAC CATATGCTGT 
0121 GGGCCTGCGA ATGAACAATG GAGCCGTGGG CGGAGGTTCC GTAATTGGAA ACAATTGGGT 
0181 CCTGACCGCT GCCCATTGCC TGACCACCGA TTCCGTGACC ATACACTACG GCTCGAATCG 
0241 TGCCTGGAAC GGTCAGCTTC AGCATACGGT GAACAAGAAT AACTTCTTTC GCCATCCAGG 
0301 ATATCCCAAT AGCGCTGGTC ACGACATCGG ACTCATTCGC ACCCCGTACG TCAGCTTCAC 
0361 CAATCTGATC AACAAAGTTT CGCTGCCCAA GTTCAGCCAA AAAGGTGAGC GTTTCGAGAA 
0421 CTGGTGGTGC GTGGCCTGCG GCTGGGGAGG AATGGCCAAT GGAGGATTGG CCGACTGGCT 
0481 GCAATGCATG GA 
 Assemble Data

8329R-3.IR_full        1   TTTGTTGCCACTGTCTGTGCCCACAGGAATCGCAATCGTACGGCTCATCATGGTGGTGG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico      1   TTTGTTGCCACTGTCTGTGCCCACAGGAATCGCAATCGTACGGCTCATCATGGTGGTGG 59


8329R-3.IR_full       61  TCCCAAGGACATCATTGTAAATGGCTATCCAGCCTACGAAGGCAAGGCACCATATGCTGT 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     61  TCCCAAGGACATCATTGTAAATGGCTATCCAGCCTACGAAGGCAAGGCACCATATGCTGT 119


8329R-3.IR_full       121 GGGCCTGCGAATGAACAATGGAGCCGTGGGCGGAGGTTCCGTAATTGGAAACAATTGGGT 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     121 GGGCCTGCGAATGAACAATGGAGCCGTGGGCGGAGGTTCCGTAATTGGAAACAATTGGGT 179


8329R-3.IR_full       181 CCTGACCGCTGCCCATTGCCTGACCACCGATTCCGTGACCATACACTACGGCTCGAATCG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     181 CCTGACCGCTGCCCATTGCCTGACCACCGATTCCGTGACCATACACTACGGCTCGAATCG 239


8329R-3.IR_full       241 TGCCTGGAACGGTCAGCTTCAGCATACGGTGAACAAGAATAACTTCTTTCGCCATCCAGG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     241 TGCCTGGAACGGTCAGCTTCAGCATACGGTGAACAAGAATAACTTCTTTCGCCATCCAGG 299


8329R-3.IR_full       301 ATATCCCAATAGCGCTGGTCACGACATCGGACTCATTCGCACCCCGTACGTCAGCTTCAC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     301 ATATCCCAATAGCGCTGGTCACGACATCGGACTCATTCGCACCCCGTACGTCAGCTTCAC 359


8329R-3.IR_full       361 CAATCTGATCAACAAAGTTTCGCTGCCCAAGTTCAGCCAAAAAGGTGAGCGTTTCGAGAA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     361 CAATCTGATCAACAAAGTTTCGCTGCCCAAGTTCAGCCAAAAAGGTGAGCGTTTCGAGAA 419


8329R-3.IR_full       421 CTGGTGGTGCGTGNCCTGCGGCTGGGGAGGAATGGCCAATGGAGGATTGGCCGACTGGCT 479
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
8329R-3.in silico     421 CTGGTGGTGCGTGGCCTGCGGCTGGGGAGGAATGGCCAATGGAGGATTGGCCGACTGGCT 479


8329R-3.IR_full       481 GCAATGCATGGA 491
                          ||||||||||||
8329R-3.in silico     481 GCAATGCATGGA 491

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   474  NM_140082.1  CG8329-RA (CG8329), mRNA 
0.21   NM_080215.2  CG18525-RA, transcript variant A (Spn5), mRNA 
0.21   NM_176501.1  CG18525-RB, transcript variant B (Spn5), mRNA 
0   29  NM_140083.1  CG18179-RA (CG18179), mRNA 
0   15  18  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   15  18  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   NM_170340.1  CG5643-RF, transcript variant F (wdb), mRNA 
0   NM_170337.1  CG5643-RB, transcript variant B (wdb), mRNA 
0   NM_170338.1  CG5643-RD, transcript variant D (wdb), mRNA 
0   NM_170341.1  CG5643-RG, transcript variant G (wdb), mRNA 
0   NM_170336.1  CG5643-RA, transcript variant A (wdb), mRNA 
0   NM_143312.2  CG5643-RC, transcript variant C (wdb), mRNA 
0   NM_170339.1  CG5643-RE, transcript variant E (wdb), mRNA 
0   11  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_001038864.1  CG4927-RC (CG4927), mRNA 
0   NM_135706.2  CG16996-RA (CG16996), mRNA 
0   19  27  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   19  20  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   16  23  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_078978.1  CG8238-RA (Buffy), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0   11  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   25  NM_140084.1  CG18180-RA (CG18180), mRNA 
0   NM_137030.1  CG4812-RA (Ser8), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_143572.2  CG12045-RA (CG12045), mRNA 
0   NM_140308.2  CG4300-RB, transcript variant B (CG4300), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.