National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8251R-1 
 Symbol Pgi  Full Name Phosphoglucose isomerase 
 CG No CG8251  Old CG No CG8251 
 Synonyms CG8251, GPI, pgi, Gpi, PGI, Pgi 
 Accession No (Link to NCBI) NM_078939.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGTTCCAGAAGCTGCAGGAG 
 Primer Seq. 3'
aatctagaggtaccTAGGGCTTCAGCGCTTCGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGTTCCAGA AGCTGCAGGA GTACTACGAC TCCAAGGGCA AGGACCTGAA CATCAAGGAC 
0061 CTGTTCGTGA AGGATTCCAA GAGATTCTCA AAATACAGCC TGCGCCTGCA CACCCAGAAC 
0121 GATGGCGAGA TACTGCTGGA CTACTCGAAG AACCGTATCA ATGACGAGGT CTGGGATCTG 
0181 CTCCTCACCC TGGCCAAGGT GCGCCGcGTT AACGCCGCGc GGGACGCCAT GTTCTCCGGC 
0241 CAGCACATTA ACATCACGGA GAACCGCGCC GTCCTCCACA CGGCCCTGCG CAACCGCGGC 
0301 ACGGNATCCC GTCCTGGTGG ACGACAAGGA CGTGATGCCC GATGTGCGCG CCGAACTGGC 
0361 CCACATGAAG GAGTTCACCA ACATGGTCAT CTCCGGCGTG TGGCGCGGCT GCACCGGCAA 
0421 ACAGATCACC GACGTGGTCA ACATCGGCAT CGGTGGCTCC GATCTGGGCC CGCTGATGNT 
0481 CACCGAAGCN CTGAAGNCCT A 
 in silico PCR Fragment
0001 GCGTTCCAGA AGCTGCAGGA GTACTACGAC TCCAAGGGCA AGGACCTGAA CATCAAGGAC 
0061 CTGTTCGTGA AGGATTCCAA GAGATTCTCA AAATACAGCC TGCGCCTGCA CACCCAGAAC 
0121 GATGGCGAGA TACTGCTGGA CTACTCGAAG AACCGTATCA ATGACGAGGT CTGGGATCTG 
0181 CTCCTCACCC TGGCCAAGGT GCGCCGCGTT AACGCCGCGC GGGACGCCAT GTTCTCCGGC 
0241 CAGCACATTA ACATCACGGA GAACCGCGCC GTCCTCCACA CGGCCCTGCG CAACCGCGGC 
0301 ACGG-ATCCC GTCCTGGTGG ACGACAAGGA CGTGATGCCC GATGTGCGCG CCGAACTGGC 
0361 CCACATGAAG GAGTTCACCA ACATGGTCAT CTCCGGCGTG TGGCGCGGCT GCACCGGCAA 
0421 ACAGATCACC GACGTGGTCA ACATCGGCAT CGGTGGCTCC GATCTGGGCC CGCTGATGGT 
0481 CACCGAAGCG CTGAAGCCCT A 
 Assemble Data

8251R-1.IR_full       1   GCGTTCCAGAAGCTGCAGGAGTACTACGACTCCAAGGGCAAGGACCTGAACATCAAGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     1   GCGTTCCAGAAGCTGCAGGAGTACTACGACTCCAAGGGCAAGGACCTGAACATCAAGGAC 60


8251R-1.IR_full       61  CTGTTCGTGAAGGATTCCAAGAGATTCTCAAAATACAGCCTGCGCCTGCACACCCAGAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     61  CTGTTCGTGAAGGATTCCAAGAGATTCTCAAAATACAGCCTGCGCCTGCACACCCAGAAC 120


8251R-1.IR_full       121 GATGGCGAGATACTGCTGGACTACTCGAAGAACCGTATCAATGACGAGGTCTGGGATCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     121 GATGGCGAGATACTGCTGGACTACTCGAAGAACCGTATCAATGACGAGGTCTGGGATCTG 180


8251R-1.IR_full       181 CTCCTCACCCTGGCCAAGGTGCGCCGCGTTAACGCCGCGCGGGACGCCATGTTCTCCGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     181 CTCCTCACCCTGGCCAAGGTGCGCCGCGTTAACGCCGCGCGGGACGCCATGTTCTCCGGC 240


8251R-1.IR_full       241 CAGCACATTAACATCACGGAGAACCGCGCCGTCCTCCACACGGCCCTGCGCAACCGCGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     241 CAGCACATTAACATCACGGAGAACCGCGCCGTCCTCCACACGGCCCTGCGCAACCGCGGC 300


8251R-1.IR_full       301 ACGGNATCCCGTCCTGGTGGACGACAAGGACGTGATGCCCGATGTGCGCGCCGAACTGGC 360
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     301 ACGG-ATCCCGTCCTGGTGGACGACAAGGACGTGATGCCCGATGTGCGCGCCGAACTGGC 360


8251R-1.IR_full       361 CCACATGAAGGAGTTCACCAACATGGTCATCTCCGGCGTGTGGCGCGGCTGCACCGGCAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8251R-1.in silico     361 CCACATGAAGGAGTTCACCAACATGGTCATCTCCGGCGTGTGGCGCGGCTGCACCGGCAA 420


8251R-1.IR_full       421 ACAGATCACCGACGTGGTCAACATCGGCATCGGTGGCTCCGATCTGGGCCCGCTGATGNT 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
8251R-1.in silico     421 ACAGATCACCGACGTGGTCAACATCGGCATCGGTGGCTCCGATCTGGGCCCGCTGATGGT 480


8251R-1.IR_full       481 CACCGAAGCNCTGAAGNCCTA 501
                          ||||||||| |||||| ||||
8251R-1.in silico     481 CACCGAAGCGCTGAAGCCCTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078939.2  CG8251-RA, transcript variant A (Pgi), mRNA 
100   482  NM_165635.1  CG8251-RB, transcript variant B (Pgi), mRNA 
100   482  NM_165636.1  CG8251-RC, transcript variant C (Pgi), mRNA 
0   NM_132114.1  CG14442-RA (CG14442), mRNA 
0   NM_132152.1  CG4607-RA, transcript variant A (CG4607), mRNA 
0   NM_167109.1  CG4607-RB, transcript variant B (CG4607), mRNA 
0   NM_079507.2  CG2530-RA (corto), mRNA 
0   NM_169580.1  CG8524-RB, transcript variant B (NK7.1), mRNA 
0   NM_142100.2  CG8524-RA, transcript variant A (NK7.1), mRNA 
0   NM_165533.1  CG1624-RA, transcript variant A (dpld), mRNA 
0   NM_165534.1  CG1624-RB, transcript variant B (dpld), mRNA 
0   NM_080033.2  CG1624-RC, transcript variant C (dpld), mRNA 
0   NM_134680.1  CG13691-RA (BBS8), mRNA 
0   NM_139846.2  CG8602-RA (CG8602), mRNA 
0   NM_138120.1  CG16936-RA (CG16936), mRNA 
0   NM_057675.3  CG8169-RA (Pms2), mRNA 
0   NM_164559.1  CG31960-RA (CG31960), mRNA 
0   NM_080307.1  CG3206-RA (Or2a), mRNA 
0   NM_140747.1  CG7460-RB (CG7460), mRNA 
0   NM_078820.2  CG7460-RB (CG7460), mRNA,2-dioxygenase CG4779-RA (hgo), mRNA 
0   11  NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   NM_001043083.1  CG34123-RB, transcript variant B (CG34123), mRNA 
0   NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_139510.2  CG11486-RG, transcript variant G (CG11486), mRNA 
0   NM_167977.1  CG11486-RM, transcript variant M (CG11486), mRNA 
0   NM_206261.1  CG11486-RF, transcript variant F (CG11486), mRNA 
0   NM_206260.1  CG11486-RH, transcript variant H (CG11486), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.