National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8243R-1 
 Symbol CG8243  Full Name CG8243 
 CG No CG8243  Old CG No CG8243 
 Synonyms CG8243 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTCCGCGACGAGGACAAC 
 Primer Seq. 3'
aatctagaggtaccTTGAGCGCCGACGCAGATGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGTCNNCG ACGAGGACAA CAAGTACTGC GTGGACTGCG ATGCCAAGGG TCCGCGCTGG 
0061 GCCTCCTGGA ACCTGGGCAT GTTTCTCTGC ATCCGCTGCG CCGGCATCCA TCGCAATCTG 
0121 GGCGTGCACA TATCGCGCGT CAAGTCCGTC AACCTGGACA CTTGGACGCC AGAGCAGGTG 
0181 ATCTCGCTGC AGCAGATGGG AAACTCGCGG GCTCGCCGTC TACGAGGCGC AGCTGCCGGA 
0241 CGGCTTCCGT CGCCCGCAGA CGGACACAGC GCTGGAGAAT TTCATCCGGG CCAAGTACGA 
0301 GCACAAGAAG TACCTGGCCC GCGAGTGGGT GCCTCCCTCG CCGCCGAAAG TGGACTGGGC 
0361 CAAGGAGATC GACGAGGAGC TTGAGCGCCA GAAGCGCAAG AAGAAGAGCA CGCAGGCCCA 
0421 GGCCACTTTG GGCCTGGCTG GAGTGNCCGG TGGCAGCGCG ACAAGCGCCT GTCCGGGTCA 
0481 TCTGCGTCGG CGCTCAA 
 in silico PCR Fragment
0001 ATGCTCCGCG ACGAGGACAA CAAGTACTGC GTGGACTGCG ATGCCAAGGG TCCGCGCTGG 
0061 GCCTCCTGGA ACCTGGGCAT GTTTCTCTGC ATCCGCTGCG CCGGCATCCA TCGCAATCTG 
0121 GGCGTGCACA TATCGCGCGT CAAGTCCGTC AACCTGGACA CTTGGACGCC AGAGCAGGTG 
0181 ATCTCGCTGC AGCAGATGGG AAACTCGCGG GCTCGCGCCG TCTACGAGGC GCAGCTGCCG 
0241 GACGGCTTCC GTCGCCCGCA GACGGACACA GCGCTGGAGA ATTTCATCCG GGCCAAGTAC 
0301 GAGCACAAGA AGTACCTGGC CCGCGAGTGG GTGCCTCCCT CGCCGCCGAA AGTGGACTGG 
0361 GCCAAGGAGA TCGACGAGGA GCTTGAGCGC CAGAAGCGCA AGAAGAAGAG CACGCAGGCC 
0421 CAGGCCACTT TGGGCCTGGC TGGAGTGGCC GGTGGCAGCG GCGACAAGCG CCTGTCCGGG 
0481 TCATCTGCGT CGGCGCTCAA  
 Assemble Data

8243R-1.IR full       1   ATGGTCNNCGACGAGGACAACAAGTACTGCGTGGACTGCGATGCCAAGGGTCCGCGCTGG 60
                          ||| ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
8243R-1.in silico     1   ATGCTCCGCGACGAGGACAACAAGTACTGCGTGGACTGCGATGCCAAGGGTCCGCGCTGG 60


8243R-1.IR full       61  GCCTCCTGGAACCTGGGCATGTTTCTCTGCATCCGCTGCGCCGGCATCCATCGCAATCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8243R-1.in silico     61  GCCTCCTGGAACCTGGGCATGTTTCTCTGCATCCGCTGCGCCGGCATCCATCGCAATCTG 120


8243R-1.IR full       121 GGCGTGCACATATCGCGCGTCAAGTCCGTCAACCTGGACACTTGGACGCCAGAGCAGGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8243R-1.in silico     121 GGCGTGCACATATCGCGCGTCAAGTCCGTCAACCTGGACACTTGGACGCCAGAGCAGGTG 180


8243R-1.IR full       181 ATCTCGCTGCAGCAGATGGGAAACTCGCGGGCTCGC--CGTCTACGAGGCGCAGCTGCCG 240
                          ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
8243R-1.in silico     181 ATCTCGCTGCAGCAGATGGGAAACTCGCGGGCTCGCGCCGTCTACGAGGCGCAGCTGCCG 240


8243R-1.IR full       241 GACGGCTTCCGTCGCCCGCAGACGGACACAGCGCTGGAGAATTTCATCCGGGCCAAGTAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8243R-1.in silico     241 GACGGCTTCCGTCGCCCGCAGACGGACACAGCGCTGGAGAATTTCATCCGGGCCAAGTAC 300


8243R-1.IR full       301 GAGCACAAGAAGTACCTGGCCCGCGAGTGGGTGCCTCCCTCGCCGCCGAAAGTGGACTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8243R-1.in silico     301 GAGCACAAGAAGTACCTGGCCCGCGAGTGGGTGCCTCCCTCGCCGCCGAAAGTGGACTGG 360


8243R-1.IR full       361 GCCAAGGAGATCGACGAGGAGCTTGAGCGCCAGAAGCGCAAGAAGAAGAGCACGCAGGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8243R-1.in silico     361 GCCAAGGAGATCGACGAGGAGCTTGAGCGCCAGAAGCGCAAGAAGAAGAGCACGCAGGCC 420


8243R-1.IR full       421 CAGGCCACTTTGGGCCTGGCTGGAGTGNCCGGTGGCAGCG-CGACAAGCGCCTGTCCGGG 480
                          ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||
8243R-1.in silico     421 CAGGCCACTTTGGGCCTGGCTGGAGTGGCCGGTGGCAGCGGCGACAAGCGCCTGTCCGGG 480


8243R-1.IR full       481 TCATCTGCGTCGGCGCTCAA 500
                          ||||||||||||||||||||
8243R-1.in silico     481 TCATCTGCGTCGGCGCTCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.