National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8230R-4 
 Symbol CG8230  Full Name CG8230 
 CG No CG8230  Old CG No CG8230 
 Synonyms BcDNA:GH02536, CG8230 
 Accession No (Link to NCBI) NM_136587.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGGCATCAACGTCAGCAGGACGGCCGACCTGGGGTCCAACCAGTGGCTCCAGCGCTTC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGGGCCGCCAGCACATCGCCCACGATGACGAGGCCTTCTGGAACGGGCTGCTCAACTAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACATTGTGCTGCCGGAGAACAGTCAGGACCAGCTCAACCTGGACAGCCGGCTAGAGGCG 180

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 C-TGTGCCAGTCGTTCATCGGCAATAACCTGAAGACGGGCAACTTTGGCTCCCTGGTGAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGTGTTCCTGGAGAAGACCAGCGAGCTGCTGTCGCTGTCGGACCAGGAAAGCAACATGCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTCTGGCAGACCTTCAACGCGCTCTTCATCATCCGCAGCCTGGTCAAGTACATCAACGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACGGGCTCTGAGTTCCAGCTGCTGCAGCACTTTGAGGCTATGCCGAATGCAGAGCTGCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAAGCGGCATTGGAGCAGCAGCAACAGACGCCGGCGGAGAGCGCCACCATTGCCATGGA 480

8230R-4.IR_full       481 GGCCACCGAACAGT 494
                          |||||||||||||| silico     481 GGCCACCGAACAGT 494

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   475  NM_136587.1  CG8230-RA (CG8230), mRNA 
0.42   18  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0.42   18  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0.42   18  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0.42   18  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0.21   NM_139907.2  CG8254-RA (exex), mRNA 
0.21   NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0.21   NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0.21   NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0   11  NM_141324.1  CG1098-RA (Madm), mRNA 
0   21  NM_078575.2  CG9355-RA (dy), mRNA 
0   20  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   20  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   NM_167595.3  CG12348-RE, transcript variant E (Sh), mRNA 
0   NM_167594.2  CG12348-RC, transcript variant C (Sh), mRNA 
0   10  NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0   NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_079549.2  CG7850-RA (puc), mRNA 
0   NM_169414.1  CG17309-RB, transcript variant B (Csk), mRNA 
0   NM_141840.1  CG17309-RA, transcript variant A (Csk), mRNA 
0   NM_169415.2  CG17309-RC, transcript variant C (Csk), mRNA 
0   NM_169416.2  CG17309-RD, transcript variant D (Csk), mRNA 
0   NM_176461.1  CG17309-RE, transcript variant E (Csk), mRNA 
0   24  NM_132584.2  CG32654-RC (CG32654), mRNA 
0   15  NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_169265.1  CG8866-RA, transcript variant A (CG8866), mRNA 
0   NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.