National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8230R-2 
 Symbol CG8230  Full Name CG8230 
 CG No CG8230  Old CG No CG8230 
 Synonyms BcDNA:GH02536, CG8230 
 Accession No (Link to NCBI) NM_136587.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGCATCAACGTCAGCAGG 
 Primer Seq. 3'
aatctagaggtaccACTGTTCGGTGGCCTCCATGG 
 Predicted Fragment Size
493 
 IR fragment full Seq
0001 ATGGGCATCA ACGTCAGCAG GACGGCCGAC CTGGGGTCCA ACCAGTGGCT CCAGCGCTTC 
0061 GTGGGCCGCC AGCACATCGC CCACGATGAC GAGGCCTTCT GGAACGGGCT GCTCAACTAC 
0121 AACATTGTGC TGCCGGAGAA CAGTCAGGAC CAGCTCAACC TGGACAGCCG GCTAGAGGCG 
0181 CNTGTGCCAG TCGTTCATCG GCAATAACCT GAAGACGGGC AACTTTGGCT CCCTGGTGAC 
0241 CGTGTTCCTG GAGAAGACCA GCGAGCTGCT GTCGCTGTCG GACCAGGAAA GCAACATGCA 
0301 CGTCTGGCAG ACCTTCAACG CGCTCTTCAT CATCCGCAGC CTGGTCAAGT ACATCAACGA 
0361 GACGGGCTCT GAGTTCCAGC TGCTGCAGCA CTTTGAGGCT ATGCCGAATG CAGAGCTGCT 
0421 GCAAGCGGCA TTGGAGCAGC AGCAACAGAC GCCGGCGGAG AGCGCCACCA TTGCCATGGA 
0481 GGCCACCGAA CAGT 
 in silico PCR Fragment
0001 ATGGGCATCA ACGTCAGCAG GACGGCCGAC CTGGGGTCCA ACCAGTGGCT CCAGCGCTTC 
0061 GTGGGCCGCC AGCACATCGC CCACGATGAC GAGGCCTTCT GGAACGGGCT GCTCAACTAC 
0121 AACATTGTGC TGCCGGAGAA CAGTCAGGAC CAGCTCAACC TGGACAGCCG GCTAGAGGCG 
0181 C-TGTGCCAG TCGTTCATCG GCAATAACCT GAAGACGGGC AACTTTGGCT CCCTGGTGAC 
0241 CGTGTTCCTG GAGAAGACCA GCGAGCTGCT GTCGCTGTCG GACCAGGAAA GCAACATGCA 
0301 CGTCTGGCAG ACCTTCAACG CGCTCTTCAT CATCCGCAGC CTGGTCAAGT ACATCAACGA 
0361 GACGGGCTCT GAGTTCCAGC TGCTGCAGCA CTTTGAGGCT ATGCCGAATG CAGAGCTGCT 
0421 GCAAGCGGCA TTGGAGCAGC AGCAACAGAC GCCGGCGGAG AGCGCCACCA TTGCCATGGA 
0481 GGCCACCGAA CAGT 
 Assemble Data

8230R-2.IR_full       1   ATGGGCATCAACGTCAGCAGGACGGCCGACCTGGGGTCCAACCAGTGGCTCCAGCGCTTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     1   ATGGGCATCAACGTCAGCAGGACGGCCGACCTGGGGTCCAACCAGTGGCTCCAGCGCTTC 60


8230R-2.IR_full       61  GTGGGCCGCCAGCACATCGCCCACGATGACGAGGCCTTCTGGAACGGGCTGCTCAACTAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     61  GTGGGCCGCCAGCACATCGCCCACGATGACGAGGCCTTCTGGAACGGGCTGCTCAACTAC 120


8230R-2.IR_full       121 AACATTGTGCTGCCGGAGAACAGTCAGGACCAGCTCAACCTGGACAGCCGGCTAGAGGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     121 AACATTGTGCTGCCGGAGAACAGTCAGGACCAGCTCAACCTGGACAGCCGGCTAGAGGCG 180


8230R-2.IR_full       181 CNTGTGCCAGTCGTTCATCGGCAATAACCTGAAGACGGGCAACTTTGGCTCCCTGGTGAC 240
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     181 C-TGTGCCAGTCGTTCATCGGCAATAACCTGAAGACGGGCAACTTTGGCTCCCTGGTGAC 240


8230R-2.IR_full       241 CGTGTTCCTGGAGAAGACCAGCGAGCTGCTGTCGCTGTCGGACCAGGAAAGCAACATGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     241 CGTGTTCCTGGAGAAGACCAGCGAGCTGCTGTCGCTGTCGGACCAGGAAAGCAACATGCA 300


8230R-2.IR_full       301 CGTCTGGCAGACCTTCAACGCGCTCTTCATCATCCGCAGCCTGGTCAAGTACATCAACGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     301 CGTCTGGCAGACCTTCAACGCGCTCTTCATCATCCGCAGCCTGGTCAAGTACATCAACGA 360


8230R-2.IR_full       361 GACGGGCTCTGAGTTCCAGCTGCTGCAGCACTTTGAGGCTATGCCGAATGCAGAGCTGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     361 GACGGGCTCTGAGTTCCAGCTGCTGCAGCACTTTGAGGCTATGCCGAATGCAGAGCTGCT 420


8230R-2.IR_full       421 GCAAGCGGCATTGGAGCAGCAGCAACAGACGCCGGCGGAGAGCGCCACCATTGCCATGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8230R-2.in silico     421 GCAAGCGGCATTGGAGCAGCAGCAACAGACGCCGGCGGAGAGCGCCACCATTGCCATGGA 480


8230R-2.IR_full       481 GGCCACCGAACAGT 494
                          ||||||||||||||
8230R-2.in silico     481 GGCCACCGAACAGT 494

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   475  NM_136587.1  CG8230-RA (CG8230), mRNA 
0.42   18  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0.42   18  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0.42   18  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0.42   18  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0.21   NM_139907.2  CG8254-RA (exex), mRNA 
0.21   NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0.21   NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0.21   NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0   11  NM_141324.1  CG1098-RA (Madm), mRNA 
0   21  NM_078575.2  CG9355-RA (dy), mRNA 
0   20  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   20  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   NM_167595.3  CG12348-RE, transcript variant E (Sh), mRNA 
0   NM_167594.2  CG12348-RC, transcript variant C (Sh), mRNA 
0   10  NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0   NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_079549.2  CG7850-RA (puc), mRNA 
0   NM_169414.1  CG17309-RB, transcript variant B (Csk), mRNA 
0   NM_141840.1  CG17309-RA, transcript variant A (Csk), mRNA 
0   NM_169415.2  CG17309-RC, transcript variant C (Csk), mRNA 
0   NM_169416.2  CG17309-RD, transcript variant D (Csk), mRNA 
0   NM_176461.1  CG17309-RE, transcript variant E (Csk), mRNA 
0   24  NM_132584.2  CG32654-RC (CG32654), mRNA 
0   15  NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_169265.1  CG8866-RA, transcript variant A (CG8866), mRNA 
0   NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.