National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8221R-4 
 Symbol Amyrel  Full Name Amyrel 
 CG No CG8221  Old CG No CG8221 
 Synonyms CG8221, Amyrel 
 Accession No (Link to NCBI) NM_057914.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGTTCGCTTTGACCCTGAC 
 Primer Seq. 3'
aatctagaggtaccGTTGCACCTGGAAGCGATCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAGTTCGCT TTGACCCTGA CGCTCTGCTT GGCGGGCAGC CTTTCGCTGG CCCAGCACAA 
0061 TCCCCATTGG TGGGGCAATC GCAACACCAT CGTCCACTTG TTCGAGTGGA AGTGGTCGGA 
0121 CATTGCCCAG GAGTGTGAGA GTTTTCTCGG ACCTCGAGGA TTCGCCGGCG TTCAAGTGAG 
0181 CCCCGTTAAT GAGAACATCT TATCGGCGGG TCGTCCGTGG TGGGAGCGAT ATCAACCCAT 
0241 CTCGTACAAG CTGACCACTC GGTCTGGTAA TGAGGAGGAA TTTGGTGACA TGGTCCGTCG 
0301 TTGCAACGAT GTGGGTGTTC GTATCTATGT GGATGTGCTG TTGAACCACA TGTCCGGAGA 
0361 TTTTGACGGT GTGGCTGTGG GCACTGCTGG AACAGAGGCG GAACCCAGTA AGAAATCCTT 
0421 CCCAGGAGTT CCATACACCG CACAGGACTT CCATCCCACC TGCGAGATTA CCGACTGGAA 
0481 CGATCGCTTC CAGGTGCAAC  
 in silico PCR Fragment
0001 CAAGTTCGCT TTGACCCTGA CGCTCTGCTT GGCGGGCAGC CTTTCGCTGG CCCAGCACAA 
0061 TCCCCATTGG TGGGGCAATC GCAACACCAT CGTCCACTTG TTCGAGTGGA AGTGGTCGGA 
0121 CATTGCCCAG GAGTGTGAGA GTTTTCTCGG ACCTCGAGGA TTCGCCGGCG TTCAAGTGAG 
0181 CCCCGTTAAT GAGAACATCT TATCGGCGGG TCGTCCGTGG TGGGAGCGAT ATCAACCCAT 
0241 CTCGTACAAG CTGACCACTC GGTCTGGTAA TGAGGAGGAA TTTGGTGACA TGGTCCGTCG 
0301 TTGCAACGAT GTGGGTGTTC GTATCTATGT GGATGTGCTG TTGAACCACA TGTCCGGAGA 
0361 TTTTGACGGT GTGGCTGTGG GCACTGCTGG AACAGAGGCG GAACCCAGTA AGAAATCCTT 
0421 CCCAGGAGTT CCATACACCG CACAGGACTT CCATCCCACC TGCGAGATTA CCGACTGGAA 
0481 CGATCGCTTC CAGGTGCAAC  
 Assemble Data

8221R-4.IR_full       1   CAAGTTCGCTTTGACCCTGACGCTCTGCTTGGCGGGCAGCCTTTCGCTGGCCCAGCACAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     1   CAAGTTCGCTTTGACCCTGACGCTCTGCTTGGCGGGCAGCCTTTCGCTGGCCCAGCACAA 60


8221R-4.IR_full       61  TCCCCATTGGTGGGGCAATCGCAACACCATCGTCCACTTGTTCGAGTGGAAGTGGTCGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     61  TCCCCATTGGTGGGGCAATCGCAACACCATCGTCCACTTGTTCGAGTGGAAGTGGTCGGA 120


8221R-4.IR_full       121 CATTGCCCAGGAGTGTGAGAGTTTTCTCGGACCTCGAGGATTCGCCGGCGTTCAAGTGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     121 CATTGCCCAGGAGTGTGAGAGTTTTCTCGGACCTCGAGGATTCGCCGGCGTTCAAGTGAG 180


8221R-4.IR_full       181 CCCCGTTAATGAGAACATCTTATCGGCGGGTCGTCCGTGGTGGGAGCGATATCAACCCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     181 CCCCGTTAATGAGAACATCTTATCGGCGGGTCGTCCGTGGTGGGAGCGATATCAACCCAT 240


8221R-4.IR_full       241 CTCGTACAAGCTGACCACTCGGTCTGGTAATGAGGAGGAATTTGGTGACATGGTCCGTCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     241 CTCGTACAAGCTGACCACTCGGTCTGGTAATGAGGAGGAATTTGGTGACATGGTCCGTCG 300


8221R-4.IR_full       301 TTGCAACGATGTGGGTGTTCGTATCTATGTGGATGTGCTGTTGAACCACATGTCCGGAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     301 TTGCAACGATGTGGGTGTTCGTATCTATGTGGATGTGCTGTTGAACCACATGTCCGGAGA 360


8221R-4.IR_full       361 TTTTGACGGTGTGGCTGTGGGCACTGCTGGAACAGAGGCGGAACCCAGTAAGAAATCCTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     361 TTTTGACGGTGTGGCTGTGGGCACTGCTGGAACAGAGGCGGAACCCAGTAAGAAATCCTT 420


8221R-4.IR_full       421 CCCAGGAGTTCCATACACCGCACAGGACTTCCATCCCACCTGCGAGATTACCGACTGGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8221R-4.in silico     421 CCCAGGAGTTCCATACACCGCACAGGACTTCCATCCCACCTGCGAGATTACCGACTGGAA 480


8221R-4.IR_full       481 CGATCGCTTCCAGGTGCAAC 500
                          ||||||||||||||||||||
8221R-4.in silico     481 CGATCGCTTCCAGGTGCAAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057914.3  CG8221-RA (Amyrel), mRNA 
0   10  24  NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   10  24  NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_169250.1  CG11980-RB, transcript variant B (CG11980), mRNA 
0   NM_141600.1  CG11980-RC, transcript variant C (CG11980), mRNA 
0   NM_169251.1  CG11980-RA, transcript variant A (CG11980), mRNA 
0   NM_001038930.1  CG33984-RA (CG33984), mRNA 
0   NM_168938.1  CG7383-RB, transcript variant B (eg), mRNA 
0   NM_079482.3  CG7383-RA, transcript variant A (eg), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 
0   NM_141771.1  CG14694-RA (CG14694), mRNA 
0   NM_135662.3  CG4970-RA, transcript variant A (CG4970), mRNA 
0   NM_135663.2  CG14929-RA, transcript variant A (CG14929), mRNA 
0   NM_001042877.1  CG13778-RC, transcript variant C (Mnn1), mRNA 
0   NM_143610.2  CG11337-RA, transcript variant A (CG11337), mRNA 
0   NM_170550.1  CG11337-RB, transcript variant B (CG11337), mRNA 
0   NM_078774.3  CG13778-RA, transcript variant A (Mnn1), mRNA 
0   NM_137671.1  CG15226-RA (CG15226), mRNA 
0   NM_137081.2  CG30483-RA (Prosap), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_140410.1  CG8760-RA (CG8760), mRNA 
0   22  76  NM_001015110.1  CG40323-PB.3 (CG40323), mRNA 
0   16  NM_138247.1  CG9134-RB, transcript variant B (CG9134), mRNA 
0   NM_167863.1  CG9134-RA, transcript variant A (CG9134), mRNA 
0   NM_167864.1  CG9134-RC, transcript variant C (CG9134), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_143046.2  CG5814-RA (CycB3), mRNA 
0   NM_001015111.1  CG40322-PA.3 (CG40322), mRNA 
0   NM_137227.2  CG8315-RA (CG8315), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.