National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8219R-1 
 Symbol CG8219  Full Name CG8219 
 CG No CG8219  Old CG No CG8219 
 Synonyms 148274_at, EP(3)3072, CG8219 
 Accession No (Link to NCBI) NM_139781.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAGCCGTGCAAGAGACGGAAA 
 Primer Seq. 3'
aatctagaggtaccGGGCACGTCTAAGAGGTTCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TAGCCGTGCA AGAGACGGAA AACGAGGCAA CNCGCTCCAT GAGCGGCCTA ATCCTCAAGA 
0061 ACAACATTCG CATGCACGAC ATCACTCTGC AGCCGGAGCA CCTGGAGTAT ATCAAACACC 
0121 AGTGCCTGCA GGCAGTGGGC GACTCTTCAC CCGAGATCCG TGGCACCGTG GGCATTCTGA 
0181 TTACCACCAT TGCCAGCAAT ATCGGTCTGC ACAACTGGCC GCAGCTGCTT CCATCTCTCT 
0241 GCGAAATGCT CGACAACCAG GACTACAATG TGTGCGAAGG AGCATTCAGT gNTCTGCAGA 
0301 AAATTTGCGA GGACTCTGCC GGAATTTTGG AAAATATGCC ATTAAATACA ATGATTCCAA 
0361 AGTTCCTGGA GTACTTTAAG cACAGCAGTC CAAAGATCCG CTCCCACGCC ATTGCCTGCA 
0421 TCAACCAGTT CATCATCAAC AGATCACAGG CCCTGATGCT AAACATAGAC AGCCTCATTC 
0481 AGAACCTCTT ANGACGTGCC c 
 in silico PCR Fragment
0001 TAGCCGTGCA AGAGACGGAA AACGAGGCAA CGCGCTCCAT GAGCGGCCTA ATCCTCAAGA 
0061 ACAACATTCG CATGCACGAC ATCACTCTGC AGCCGGAACA CCTGGAGTAT ATCAAACACC 
0121 AGTGCCTGCA GGCAGTGGGC GACTCTTCAC CCGAGATCCG TGGCACCGTG GGCATTCTGA 
0181 TTACCACCAT TGCCAGCAAT ATCGGTCTGC ACAACTGGCC GCAGCTGCTT CCATCTCTCT 
0241 GCGAAATGCT CGACAACCAG GACTACAATG TGTGCGAAGG AGCATTCAGT GCTCTGCAGA 
0301 AAATTTGCGA GGACTCTGCC GGAATTTTGG AAAATATGCC ATTAAATACA ATGATTCCAA 
0361 AGTTCCTGGA GTACTTTAAG CACAGCAGTC CAAAGATCCG CTCCCACGCC ATTGCCTGCA 
0421 TCAACCAGTT CATCATCAAC AGATCACAGG CCCTGATGCT AAACATAGAC AGCCTCATTC 
0481 AGAACCTCTT A-GACGTGCC C 
 Assemble Data

8219R-1.IR_full       1   TAGCCGTGCAAGAGACGGAAAACGAGGCAACNCGCTCCATGAGCGGCCTAATCCTCAAGA 60
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
8219R-1.in silico     1   TAGCCGTGCAAGAGACGGAAAACGAGGCAACGCGCTCCATGAGCGGCCTAATCCTCAAGA 60


8219R-1.IR_full       61  ACAACATTCGCATGCACGACATCACTCTGCAGCCGGAGCACCTGGAGTATATCAAACACC 120
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
8219R-1.in silico     61  ACAACATTCGCATGCACGACATCACTCTGCAGCCGGAACACCTGGAGTATATCAAACACC 120


8219R-1.IR_full       121 AGTGCCTGCAGGCAGTGGGCGACTCTTCACCCGAGATCCGTGGCACCGTGGGCATTCTGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8219R-1.in silico     121 AGTGCCTGCAGGCAGTGGGCGACTCTTCACCCGAGATCCGTGGCACCGTGGGCATTCTGA 180


8219R-1.IR_full       181 TTACCACCATTGCCAGCAATATCGGTCTGCACAACTGGCCGCAGCTGCTTCCATCTCTCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8219R-1.in silico     181 TTACCACCATTGCCAGCAATATCGGTCTGCACAACTGGCCGCAGCTGCTTCCATCTCTCT 240


8219R-1.IR_full       241 GCGAAATGCTCGACAACCAGGACTACAATGTGTGCGAAGGAGCATTCAGTGNTCTGCAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
8219R-1.in silico     241 GCGAAATGCTCGACAACCAGGACTACAATGTGTGCGAAGGAGCATTCAGTGCTCTGCAGA 300


8219R-1.IR_full       301 AAATTTGCGAGGACTCTGCCGGAATTTTGGAAAATATGCCATTAAATACAATGATTCCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8219R-1.in silico     301 AAATTTGCGAGGACTCTGCCGGAATTTTGGAAAATATGCCATTAAATACAATGATTCCAA 360


8219R-1.IR_full       361 AGTTCCTGGAGTACTTTAAGCACAGCAGTCCAAAGATCCGCTCCCACGCCATTGCCTGCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8219R-1.in silico     361 AGTTCCTGGAGTACTTTAAGCACAGCAGTCCAAAGATCCGCTCCCACGCCATTGCCTGCA 420


8219R-1.IR_full       421 TCAACCAGTTCATCATCAACAGATCACAGGCCCTGATGCTAAACATAGACAGCCTCATTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8219R-1.in silico     421 TCAACCAGTTCATCATCAACAGATCACAGGCCCTGATGCTAAACATAGACAGCCTCATTC 480


8219R-1.IR_full       481 AGAACCTCTTANGACGTGCCC 501
                          ||||||||||| |||||||||
8219R-1.in silico     481 AGAACCTCTTA-GACGTGCCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139781.1  CG8219-RA (CG8219), mRNA 
28.21   136  138  85  36  NM_168161.1  CG7398-RC, transcript variant C (Trn), mRNA 
28.21   136  138  85  36  NM_168160.1  CG7398-RB, transcript variant B (Trn), mRNA 
28.21   136  138  85  36  NM_058020.3  CG7398-RA, transcript variant A (Trn), mRNA 
0   NM_143765.2  CG12218-RA (mei-P26), mRNA 
0   NM_135531.2  CG4968-RA (CG4968), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_057939.3  CG4579-RA, transcript variant A (Nup154), mRNA 
0   NM_057940.3  CG4579-RB, transcript variant B (Nup154), mRNA 
0   NM_168000.1  CG17569-RA, transcript variant A (gry), mRNA 
0   NM_139528.2  CG17569-RB, transcript variant B (gry), mRNA 
0   NM_079574.2  CG9474-RA (Snap24), mRNA 
0   NM_057692.2  CG9884-RA, transcript variant A (oaf), mRNA 
0   NM_175949.1  CG9884-RD, transcript variant D (oaf), mRNA 
0   NM_136636.3  CG13739-RA (CG13739), mRNA 
0   NM_137397.1  CG30106-RA (CG30106), mRNA 
0   NM_143134.1  CG11909-RA (CG11909), mRNA 
0   NM_132912.1  CG4521-RA (mthl1), mRNA 
0   NM_166045.1  CG4521-RA (mthl1), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA 
0   NM_166046.1  CG4521-RA (mthl1), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA,water dikinase CG8553-RB, transcript variant B (SelD), mRNA 
0   NM_140828.2  CG3797-RA (CG3797), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   10  NM_206691.2  CG1817-RA, transcript variant A (Ptp10D), mRNA 
0   10  NM_206690.1  CG1817-RD, transcript variant D (Ptp10D), mRNA 
0   10  NM_167292.2  CG1817-RB, transcript variant B (Ptp10D), mRNA 
0   NM_165880.1  CG8841-RC, transcript variant C (CG8841), mRNA 
0   NM_136916.2  CG8841-RA, transcript variant A (CG8841), mRNA 
0   NM_165879.1  CG8841-RB, transcript variant B (CG8841), mRNA 
0   NM_057973.3  CG2864-RA (Parg), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
DM
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.