National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8114R-1 
 Symbol pbl  Full Name pebble 
 CG No CG8114  Old CG No CG8114 
 Synonyms pebble, CG8114, PBL, l(3)09645, 0542/03, 0293/09, 0083/20, anon-WO0172774.25, anon-WO0172774.22, pbl, PEBBLE 
 Accession No (Link to NCBI) NM_168241.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGAAGAGCAATCGAAGTGCG 
 Primer Seq. 3'
aatctagaggtaccCCGAAAGGTTTTGGCGTACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGAAGAGCA ATCGAAGTGC GAGATGTCCA TAACAACGCT GCCCACGCGC ATCTGCCTGG 
0061 TGGGAGGCGT TGGCCAGGAT GCGGACACgC TGCAGGCAGC CGAATCCTTT GGCCTGCCCA 
0121 TCGTTACGTC GGACACGGGT CTGGACATTC TCGGAGAGTC GTCGGACTGG CGGACATTCT 
0181 ACGTGCTGGA TGACTTCGAG GGTGCCAGCT TCGAGGCGAT ACACAAGCAA AAGGAATGCA 
0241 TTCTGGGACC GCCGGCTTTG AAGTACGCGG CCGAGATGAA ACAGACACTG GGCCAGAACT 
0301 CGCGGCCCAT TTACAATTAC GCGATGCGCG GCGTGGTCAC TTGCTTTACA GGCATACGCA 
0361 AGAAGGATGA GCTGACAAAG CTGGTCAATC TCATTCACTC GATGGGTGGC TGCATCAAGA 
0421 AGGACCTGAA CACGAAGACC ACGCATTTGA TTTGCAACCA CAGTGGCGGC GAAAAGTACC 
0481 AGTACGCCAA AACCTTTCGG  
 in silico PCR Fragment
0001 TTGAAGAGCA ATCGAAGTGC GAGATGTCCA TAACAACGCT GCCCACGCGC ATCTGCCTGG 
0061 TGGGAGGCGT TGGCCAGGAT GCGGACACGC TGCAGGCAGC CGAATCCTTT GGCCTGCCCA 
0121 TCGTTACGTC GGACACGGGT CTGGACATTC TCGGAGAGTC GTCGGACTGG CGGACATTCT 
0181 ACGTGCTGGA TGACTTCGAG GGTGCCAGCT TCGAGGCGAT ACACAAGCAA AAGGAATGCA 
0241 TTCTGGGACC GCCGGCTTTG AAGTACGCGG CCGAGATGAA ACAGACACTG GGCCAGAACT 
0301 CGCGGCCCAT TTACAATTAC GCGATGCGCG GCGTGGTCAC TTGTTTTACA GGCATACGCA 
0361 AGAAGGATGA GCTGACAAAG CTGGTCAATC TCATTCACTC GATGGGTGGC TGCATCAAGA 
0421 AGGACCTGAA CACGAAGACC ACGCATTTGA TTTGCAACCA CAGTGGCGGC GAAAAGTACC 
0481 AGTACGCCAA AACCTTTCGG  
 Assemble Data

8114R-1.IR_full       1   TTGAAGAGCAATCGAAGTGCGAGATGTCCATAACAACGCTGCCCACGCGCATCTGCCTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     1   TTGAAGAGCAATCGAAGTGCGAGATGTCCATAACAACGCTGCCCACGCGCATCTGCCTGG 60


8114R-1.IR_full       61  TGGGAGGCGTTGGCCAGGATGCGGACACGCTGCAGGCAGCCGAATCCTTTGGCCTGCCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     61  TGGGAGGCGTTGGCCAGGATGCGGACACGCTGCAGGCAGCCGAATCCTTTGGCCTGCCCA 120


8114R-1.IR_full       121 TCGTTACGTCGGACACGGGTCTGGACATTCTCGGAGAGTCGTCGGACTGGCGGACATTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     121 TCGTTACGTCGGACACGGGTCTGGACATTCTCGGAGAGTCGTCGGACTGGCGGACATTCT 180


8114R-1.IR_full       181 ACGTGCTGGATGACTTCGAGGGTGCCAGCTTCGAGGCGATACACAAGCAAAAGGAATGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     181 ACGTGCTGGATGACTTCGAGGGTGCCAGCTTCGAGGCGATACACAAGCAAAAGGAATGCA 240


8114R-1.IR_full       241 TTCTGGGACCGCCGGCTTTGAAGTACGCGGCCGAGATGAAACAGACACTGGGCCAGAACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     241 TTCTGGGACCGCCGGCTTTGAAGTACGCGGCCGAGATGAAACAGACACTGGGCCAGAACT 300


8114R-1.IR_full       301 CGCGGCCCATTTACAATTACGCGATGCGCGGCGTGGTCACTTGCTTTACAGGCATACGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
8114R-1.in silico     301 CGCGGCCCATTTACAATTACGCGATGCGCGGCGTGGTCACTTGTTTTACAGGCATACGCA 360


8114R-1.IR_full       361 AGAAGGATGAGCTGACAAAGCTGGTCAATCTCATTCACTCGATGGGTGGCTGCATCAAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     361 AGAAGGATGAGCTGACAAAGCTGGTCAATCTCATTCACTCGATGGGTGGCTGCATCAAGA 420


8114R-1.IR_full       421 AGGACCTGAACACGAAGACCACGCATTTGATTTGCAACCACAGTGGCGGCGAAAAGTACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8114R-1.in silico     421 AGGACCTGAACACGAAGACCACGCATTTGATTTGCAACCACAGTGGCGGCGAAAAGTACC 480


8114R-1.IR_full       481 AGTACGCCAAAACCTTTCGG 500
                          ||||||||||||||||||||
8114R-1.in silico     481 AGTACGCCAAAACCTTTCGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168241.1  CG8114-RA, transcript variant A (pbl), mRNA 
100   482  NM_079241.2  CG8114-RB, transcript variant B (pbl), mRNA 
50.62   244  NM_168242.1  CG8114-RC, transcript variant C (pbl), mRNA 
50.62   244  NM_168243.1  CG8114-RD, transcript variant D (pbl), mRNA 
0   NM_144384.2  CG2958-RA (lectin-24Db), mRNA 
0   NM_131920.2  CG6379-RA (CG6379), mRNA 
0   NM_142387.1  CG7643-RA (ald), mRNA 
0   NM_132644.1  CG1622-RA (CG1622), mRNA 
0   NM_133134.2  CG12359-RA (Ulp1), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_141083.2  CG11306-RA (CG11306), mRNA 
0   NM_140926.1  CG13811-RA (CG13811), mRNA 
0   NM_130513.2  CG3711-RA, transcript variant A (CG3711), mRNA 
0   NM_001038730.1  CG3711-RB, transcript variant B (CG3711), mRNA 
0   NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   NM_165153.1  CG31817-RA (CG31817), mRNA 
0   11  NM_137151.2  CG10212-RA (SMC2), mRNA 
0   10  NM_139892.1  CG12262-RA (CG12262), mRNA 
0   NM_205960.1  CG4705-RB, transcript variant B (CG4705), mRNA 
0   NM_135641.2  CG4705-RA, transcript variant A (CG4705), mRNA 
0   NM_142957.1  CG13605-RA (CG13605), mRNA 
0   NM_166707.1  CG9380-RB, transcript variant B (CG9380), mRNA 
0   NM_001043106.1  CG9380-RC, transcript variant C (CG9380), mRNA 
0   NM_058115.3  CG2859-RA (Taf10), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_078872.4  CG10302-RA (bsf), mRNA 
0   NM_135640.1  CG16854-RA (CG16854), mRNA 
0   NM_057953.3  CG3998-RA (zf30C), mRNA 
0   10  NM_140007.1  CG5747-RA (mfr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.