National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8111R-2 
 Symbol CG8111  Full Name CG8111 
 CG No CG8111  Old CG No CG8111 
 Synonyms CG8111 
 Accession No (Link to NCBI) NM_139905.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGAAACACTTCGTAGCCACT 
 Primer Seq. 3'
aatctagaggtaccGCGTCCAATGAAGACGGCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGAAACACT TCGTAGCCAC TGGCCCATCG CTTTGTTCGG TGTGATCCTC TTCGTGGCTG 
0061 GGGGCACGGA GCTCTACTGG AACGAGGGAC GAGCCGTGCA CAATATGATG GCGCTGGACG 
0121 AGGCACACGC CGACATCTAC TCGGTGCGCT TCACGGAGGA GGAACAGGAG GTGGGCCTCG 
0181 AGGGCAGAAT CGTTCACCTA TCCGGACCCA TTCNCGTGGG CGAACCGCTC ACCGAACCTG 
0241 ACTACAACAT TCAGCTGCTG GCGGTGAANG CTCCGGCGAC GCGTCCAAAT GTACCAGTGG 
0301 GTCGAGGAGG CGGTCGAGCA CAACTACGGC GACAGCGTGG GAACGACGCA TTCGGACTCC 
0361 CGCACCTACT ATTACACGCG GGAATGGCGT GATAAGATCG TGGACTCGCG AAACTTCTAC 
0421 AACCGCCACG GACACACGAA TCCCAGTCAC TTTCCCATCG AAAGCCACGT TCAGGTGGCG 
0481 GATGCCGTCT TCANTGGACG N 
 in silico PCR Fragment
0001 GCGAAACACT TCGTAGCCAC TGGCCCATCG CTTTGTTCGG TGTGATCCTC TTCGTGGCTG 
0061 GGGGCACGGA GCTCTACTGG AACGAGGGAC GAGCCGTGCA CAATATGATG GCGCTGGACG 
0121 AGGCACACGC CGACATCTAC TCGGTGCGCT TCACGGAGGA GGAACAGGAG GTGGGCCTCG 
0181 AGGGCAGAAT CGTTCACCTA TCCGGACCCA TTCTCGTGGG CGAACCGCTC ACCGAACCCG 
0241 ACTACAACAT TCAGTTGCTG GCGGTGAA-G CTCCGGCGAC GCGTCCAAAT GTACCAGTGG 
0301 GTCGAGGAGG CGGTCGAGCA CAACTACGGC GACAGCGTGG GAACGACGCA TTCGGACTCC 
0361 CGCACCTACT ATTACACGCG GGAATGGCGT GATAAGATCG TGGACTCGCG AAACTTCTAC 
0421 AACCGCCACG GACACACGAA TCCCAGTCAC TTTCCCATCG AAAGCCACGT TCAGGTGGCG 
0481 GATGCCGTCT TCATTGGACG C 
 Assemble Data

8111R-2.IR_full       1   GCGAAACACTTCGTAGCCACTGGCCCATCGCTTTGTTCGGTGTGATCCTCTTCGTGGCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8111R-2.in silico     1   GCGAAACACTTCGTAGCCACTGGCCCATCGCTTTGTTCGGTGTGATCCTCTTCGTGGCTG 60


8111R-2.IR_full       61  GGGGCACGGAGCTCTACTGGAACGAGGGACGAGCCGTGCACAATATGATGGCGCTGGACG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8111R-2.in silico     61  GGGGCACGGAGCTCTACTGGAACGAGGGACGAGCCGTGCACAATATGATGGCGCTGGACG 120


8111R-2.IR_full       121 AGGCACACGCCGACATCTACTCGGTGCGCTTCACGGAGGAGGAACAGGAGGTGGGCCTCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8111R-2.in silico     121 AGGCACACGCCGACATCTACTCGGTGCGCTTCACGGAGGAGGAACAGGAGGTGGGCCTCG 180


8111R-2.IR_full       181 AGGGCAGAATCGTTCACCTATCCGGACCCATTCNCGTGGGCGAACCGCTCACCGAACCTG 240
                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
8111R-2.in silico     181 AGGGCAGAATCGTTCACCTATCCGGACCCATTCTCGTGGGCGAACCGCTCACCGAACCCG 240


8111R-2.IR_full       241 ACTACAACATTCAGCTGCTGGCGGTGAANGCTCCGGCGACGCGTCCAAATGTACCAGTGG 300
                          |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||
8111R-2.in silico     241 ACTACAACATTCAGTTGCTGGCGGTGAA-GCTCCGGCGACGCGTCCAAATGTACCAGTGG 300


8111R-2.IR_full       301 GTCGAGGAGGCGGTCGAGCACAACTACGGCGACAGCGTGGGAACGACGCATTCGGACTCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8111R-2.in silico     301 GTCGAGGAGGCGGTCGAGCACAACTACGGCGACAGCGTGGGAACGACGCATTCGGACTCC 360


8111R-2.IR_full       361 CGCACCTACTATTACACGCGGGAATGGCGTGATAAGATCGTGGACTCGCGAAACTTCTAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8111R-2.in silico     361 CGCACCTACTATTACACGCGGGAATGGCGTGATAAGATCGTGGACTCGCGAAACTTCTAC 420


8111R-2.IR_full       421 AACCGCCACGGACACACGAATCCCAGTCACTTTCCCATCGAAAGCCACGTTCAGGTGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8111R-2.in silico     421 AACCGCCACGGACACACGAATCCCAGTCACTTTCCCATCGAAAGCCACGTTCAGGTGGCG 480


8111R-2.IR_full       481 GATGCCGTCTTCANTGGACGN 501
                          ||||||||||||| |||||| 
8111R-2.in silico     481 GATGCCGTCTTCATTGGACGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139905.2  CG8111-RA (CG8111), mRNA 
0.41   NM_057490.3  CG6702-RA (Cbp53E), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_141240.1  CG14656-RA (CG14656), mRNA 
0   NM_167559.1  CG32564-RA (CG32564), mRNA 
0   NM_165086.1  CG15288-RB, transcript variant B (wb), mRNA 
0   NM_057442.3  CG15288-RA, transcript variant A (wb), mRNA 
0   10  NM_165917.1  CG8815-RD, transcript variant D (Sin3A), mRNA 
0   10  NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   10  NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_001043127.1  CG34121-RA (CG34121), mRNA 
0   NM_131929.1  CG12691-RA (CG12691), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
0   NM_165278.1  CG10501-RB, transcript variant B (amd), mRNA 
0   NM_176682.1  CG2930-RD, transcript variant D (CG2930), mRNA 
0   NM_167341.1  CG32650-RA (CG32650), mRNA 
0   NM_134586.1  CG15446-RA (CG15446), mRNA 
0   NM_136031.2  CG31786-RA (CG31786), mRNA 
0   NM_078551.2  CG2227-RA (Gip), mRNA 
0   NM_138020.2  CG3105-RA (CG3105), mRNA 
0   NM_165246.1  CG31802-RA (CG31802), mRNA 
0   NM_143719.2  CG12396-RA (Nnp-1), mRNA 
0   NM_143524.2  CG9743-RA (CG9743), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_135731.1  CG15488-RA (CG15488), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.