National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8100R-2 
 Symbol CG8100  Full Name CG8100 
 CG No CG8100  Old CG No CG8100 
 Synonyms CG8100 
 Accession No (Link to NCBI) NM_140436.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGATTTTCGAGAGCGAGTGC 
 Primer Seq. 3'
aatctagaggtaccCCAGTGTGAGTTCAGTTCCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGATTTTCG AGAGCGAGTG CATCAGAATC GAGTTCCGGG TCCGtTTGTC ATTTTAAATC 
0061 AGCTCGATAG AGGAAATGCC CCTGAATTTG TTGGGAATCT ATCGTTTTTT TGGCCATGGC 
0121 TGTGGATTGG CCATCCTTCC AGCGAAATGC TTGCTATGCC AGGATACACT TTCATCCTCT 
0181 GCTATTTGTA AACGCCCTTC AAATGGCAGT GGAGGAAAGG GAGGACACCG AAAGACCTTC 
0241 GGATGCCAGC CATGTATGAG GTGCTGCCTC AGCTGTATTT CGAAAAGGAG GTAATCCTGA 
0301 CGGCACAAGA AGTGACTTGG AACCAATTGA GCCCCATTAG GTTGGTGACA CCGAAACGAA 
0361 GATGGATTGA TATCCTTTTG GGATATCGAA ACCCCAAGCA ACCTTGGATG GAAGAGGAAC 
0421 CTATTCCAAC CGATCCTCTG ATCATTGATA ATGCACGAAA AGTGGCTTAT CTGAGCCTAG 
0481 ACTTGGAACT GAACTCACAC TGG 
 in silico PCR Fragment
0001 AAGATTTTCG AGAGCGAGTG CATCAGAATC GAGTTCCGGG TCCGTTTGTC ATTTTAAATC 
0061 AGCTCGAT-G AGGAAATGCC CCTGAATTTG TTGGGAATCT ATCG-TTTTT TGACCATGGC 
0121 TGTGGATTGG ACATCCTTCC AGCGAAATGC TTGCTTTGCC AGGATACACT TTCATCCTCT 
0181 GCTATTTGTA AACGCCCTTC AAATGGCAGT GGAGGAAAGG GAGGACACC- AAAGACCTTC 
0241 GGATGCCAGC CATGTATGAG GTGCTGCCTC AGCTGTATTT CGAAAAGGAG GTAATCCTGA 
0301 CGGCACAGGA AGTGACTTGG AACCAATTGA GCCCCATTAG GTTGGTGACA CCGAAACGAA 
0361 GATGGATTGA TATCCTTTTG GGATATCGAA ACCCCAAGCA ACCTTGGATG GAAGAGGAAC 
0421 CTATTCCAAC CGATCCTCTG ATCATTGATA ATGCACGAAA AGTGGCTTAT CTGAGCCTAG 
0481 ACTTGGAACT GAACTCACAC TGG 
 Assemble Data

8100R-2.IR_full       1   AAGATTTTCGAGAGCGAGTGCATCAGAATCGAGTTCCGGGTCCGTTTGTCATTTTAAATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8100R-2.in silico     1   AAGATTTTCGAGAGCGAGTGCATCAGAATCGAGTTCCGGGTCCGTTTGTCATTTTAAATC 60


8100R-2.IR_full       61  AGCTCGATAGAGGAAATGCCCCTGAATTTGTTGGGAATCTATCGTTTTTTTGGCCATGGC 120
                          |||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||
8100R-2.in silico     61  AGCTCGAT-GAGGAAATGCCCCTGAATTTGTTGGGAATCTATCG-TTTTTTGACCATGGC 120


8100R-2.IR_full       121 TGTGGATTGGCCATCCTTCCAGCGAAATGCTTGCTATGCCAGGATACACTTTCATCCTCT 180
                          |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||
8100R-2.in silico     121 TGTGGATTGGACATCCTTCCAGCGAAATGCTTGCTTTGCCAGGATACACTTTCATCCTCT 180


8100R-2.IR_full       181 GCTATTTGTAAACGCCCTTCAAATGGCAGTGGAGGAAAGGGAGGACACCGAAAGACCTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
8100R-2.in silico     181 GCTATTTGTAAACGCCCTTCAAATGGCAGTGGAGGAAAGGGAGGACACC-AAAGACCTTC 240


8100R-2.IR_full       241 GGATGCCAGCCATGTATGAGGTGCTGCCTCAGCTGTATTTCGAAAAGGAGGTAATCCTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8100R-2.in silico     241 GGATGCCAGCCATGTATGAGGTGCTGCCTCAGCTGTATTTCGAAAAGGAGGTAATCCTGA 300


8100R-2.IR_full       301 CGGCACAAGAAGTGACTTGGAACCAATTGAGCCCCATTAGGTTGGTGACACCGAAACGAA 360
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
8100R-2.in silico     301 CGGCACAGGAAGTGACTTGGAACCAATTGAGCCCCATTAGGTTGGTGACACCGAAACGAA 360


8100R-2.IR_full       361 GATGGATTGATATCCTTTTGGGATATCGAAACCCCAAGCAACCTTGGATGGAAGAGGAAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8100R-2.in silico     361 GATGGATTGATATCCTTTTGGGATATCGAAACCCCAAGCAACCTTGGATGGAAGAGGAAC 420


8100R-2.IR_full       421 CTATTCCAACCGATCCTCTGATCATTGATAATGCACGAAAAGTGGCTTATCTGAGCCTAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8100R-2.in silico     421 CTATTCCAACCGATCCTCTGATCATTGATAATGCACGAAAAGTGGCTTATCTGAGCCTAG 480


8100R-2.IR_full       481 ACTTGGAACTGAACTCACACTGG 503
                          |||||||||||||||||||||||
8100R-2.in silico     481 ACTTGGAACTGAACTCACACTGG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140436.1  CG8100-RA (CG8100), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   16  NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_137509.2  CG5482-RA (CG5482), mRNA 
0   NM_140800.2  CG6884-RA (MED11), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_139522.1  CG14964-RA (CG14964), mRNA 
0   NM_169858.1  CG5316-RC, transcript variant C (CG5316), mRNA 
0   NM_142548.1  CG5316-RB, transcript variant B (CG5316), mRNA 
0   NM_137356.1  CG10950-RA (CG10950), mRNA 
0   NM_137901.1  CG9896-RA (CG9896), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_001042895.1  CG31731-RB, transcript variant B (CG31731), mRNA 
0   NM_130606.2  CG3573-RA (CG3573), mRNA 
0   NM_165058.3  CG31731-RA, transcript variant A (CG31731), mRNA 
0   NM_167470.1  CG18102-RD, transcript variant D (shi), mRNA 
0   NM_141005.1  CG3618-RA (CG3618), mRNA 
0   NM_206743.1  CG18102-RF, transcript variant F (shi), mRNA 
0   NM_206742.1  CG18102-RG, transcript variant G (shi), mRNA 
0   NM_137713.2  CG4266-RA (CG4266), mRNA 
0   NM_206744.2  CG18102-RE, transcript variant E (shi), mRNA 
0   NM_001042813.1  CG18102-RH, transcript variant H (shi), mRNA 
0   NM_167471.3  CG18102-RB, transcript variant B (shi), mRNA 
0   NM_206745.2  CG18102-RA, transcript variant A (shi), mRNA 
0   NM_080114.3  CG18102-RC, transcript variant C (shi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.