National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8100R-1 
 Symbol CG8100  Full Name CG8100 
 CG No CG8100  Old CG No CG8100 
 Synonyms CG8100 
 Accession No (Link to NCBI) NM_140436.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGATTTTCGAGAGCGAGTGCATCAGAATCGAGTTCCGGGTCCGTTTGTCATTTTAAATC 60

                          |||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||| silico     61  AGCTCGAT-GAGGAAATGCCCCTGAATTTGTTGGGAATCTATCG-TTTTTTGACCATGGC 120

                          |||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| silico     121 TGTGGATTGGACATCCTTCCAGCGAAATGCTTGCTTTGCCAGGATACACTTTCATCCTCT 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     181 GCTATTTGTAAACGCCCTTCAAATGGCAGTGGAGGAAAGGGAGGACACC-AAAGACCTTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGATGCCAGCCATGTATGAGGTGCTGCCTCAGCTGTATTTCGAAAAGGAGGTAATCCTGA 300

                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGCACAGGAAGTGACTTGGAACCAATTGAGCCCCATTAGGTTGGTGACACCGAAACGAA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATGGATTGATATCCTTTTGGGATATCGAAACCCCAAGCAACCTTGGATGGAAGAGGAAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTATTCCAACCGATCCTCTGATCATTGATAATGCACGAAAAGTGGCTTATCTGAGCCTAG 480

8100R-1.IR_full       481 ACTTGGAACTGAACTCACACTGG 503
                          ||||||||||||||||||||||| silico     481 ACTTGGAACTGAACTCACACTGG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140436.1  CG8100-RA (CG8100), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   16  NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_137509.2  CG5482-RA (CG5482), mRNA 
0   NM_140800.2  CG6884-RA (MED11), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_139522.1  CG14964-RA (CG14964), mRNA 
0   NM_169858.1  CG5316-RC, transcript variant C (CG5316), mRNA 
0   NM_142548.1  CG5316-RB, transcript variant B (CG5316), mRNA 
0   NM_137356.1  CG10950-RA (CG10950), mRNA 
0   NM_137901.1  CG9896-RA (CG9896), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_001042895.1  CG31731-RB, transcript variant B (CG31731), mRNA 
0   NM_130606.2  CG3573-RA (CG3573), mRNA 
0   NM_165058.3  CG31731-RA, transcript variant A (CG31731), mRNA 
0   NM_167470.1  CG18102-RD, transcript variant D (shi), mRNA 
0   NM_141005.1  CG3618-RA (CG3618), mRNA 
0   NM_206743.1  CG18102-RF, transcript variant F (shi), mRNA 
0   NM_206742.1  CG18102-RG, transcript variant G (shi), mRNA 
0   NM_137713.2  CG4266-RA (CG4266), mRNA 
0   NM_206744.2  CG18102-RE, transcript variant E (shi), mRNA 
0   NM_001042813.1  CG18102-RH, transcript variant H (shi), mRNA 
0   NM_167471.3  CG18102-RB, transcript variant B (shi), mRNA 
0   NM_206745.2  CG18102-RA, transcript variant A (shi), mRNA 
0   NM_080114.3  CG18102-RC, transcript variant C (shi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.