National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8098R-2 
 Symbol Picot  Full Name Picot 
 CG No CG8098  Old CG No CG8098 
 Synonyms picot, CG8098, Picot 
 Accession No (Link to NCBI) NM_137302.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCCTCTTCGCATCCCACTAT 
 Primer Seq. 3'
aatctagaggtaccGGTCCAAGTGGTTGATCTTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCCTCTTCG CATCCCACTA TTGATGAGCG CGAGAAGAAG TACATTAACG ATTCCCTCTG 
0061 GGGAACTGAT GTTGTTAAGA GCCCTCCCAT TCCCTTCAAG GCTATCATCA AGTCGCTGCC 
0121 CTTCTACGCC ATTCTGTTCG CCCACATGGG TCACAACTAC GGCTATGAGA CTCTGATGAC 
0181 CGAGCTGCCC ACCTACATGA AGCAGGTGCT CCGCNTTCTC CCTGAAGTCG AACGGTCTGC 
0241 TCAGCTCCCT GCCCTACTTG GCCATGTGGC TCTNTCTCCA TGTTCATCTC GGTGGTCGCC 
0301 GATTGGATGA TTAGCTCGAA GAGATTCTCN GCACACGGCC ACCAGGAAGC TGATCAACAG 
0361 TATTGGCCAG TATGGACCGG GAGTCGCCCT AATCGCCGCC TCCTACACGG GCTGCGACAG 
0421 AGCACTGACC TTGGCCATCC TCACCATCGG AGTGGGTCTT AATGGAGGTA TCTACTCCGG 
0481 CTTCAAGATC AACCACTTGG ACC 
 in silico PCR Fragment
0001 TCCCTCTTCG CATCCCACTA TTGATGAGCG CGAGAAGAAG TACATTAACG ATTCCCTCTG 
0061 GGGAACTGAT GTTGTTAAGA GCCCTCCCAT TCCCTTCAAG GCTATCATCA AGTCGCTGCC 
0121 CTTCTACGCC ATTCTGTTCG CCCACATGGG TCACAACTAC GGCTATGAGA CTCTGATGAC 
0181 CGAGCTGCCC ACCTACATGA AGCAGGTGCT CCGC-TTCTC CCTGAAGTCG AACGGTCTGC 
0241 TCAGCTCCCT GCCCTACTTG GCCATGTGGC TCT-TCTCCA TGTTCATCTC GGTGGTCGCC 
0301 GATTGGATGA TTAGCTCGAA GAGATTCTC- GCACACGGCC ACCAGGAAGC TGATCAACAG 
0361 TATTGGCCAG TATGGACCGG GAGTCGCCCT AATCGCCGCC TCCTACACGG GCTGCGACAG 
0421 AGCACTGACC TTGGCCATCC TCACCATCGG AGTGGGTCTT AATGGAGGTA TCTACTCCGG 
0481 CTTCAAGATC AACCACTTGG ACC 
 Assemble Data

8098R-2.IR_full       1   TCCCTCTTCGCATCCCACTATTGATGAGCGCGAGAAGAAGTACATTAACGATTCCCTCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8098R-2.in silico     1   TCCCTCTTCGCATCCCACTATTGATGAGCGCGAGAAGAAGTACATTAACGATTCCCTCTG 60


8098R-2.IR_full       61  GGGAACTGATGTTGTTAAGAGCCCTCCCATTCCCTTCAAGGCTATCATCAAGTCGCTGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8098R-2.in silico     61  GGGAACTGATGTTGTTAAGAGCCCTCCCATTCCCTTCAAGGCTATCATCAAGTCGCTGCC 120


8098R-2.IR_full       121 CTTCTACGCCATTCTGTTCGCCCACATGGGTCACAACTACGGCTATGAGACTCTGATGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8098R-2.in silico     121 CTTCTACGCCATTCTGTTCGCCCACATGGGTCACAACTACGGCTATGAGACTCTGATGAC 180


8098R-2.IR_full       181 CGAGCTGCCCACCTACATGAAGCAGGTGCTCCGCNTTCTCCCTGAAGTCGAACGGTCTGC 240
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
8098R-2.in silico     181 CGAGCTGCCCACCTACATGAAGCAGGTGCTCCGC-TTCTCCCTGAAGTCGAACGGTCTGC 240


8098R-2.IR_full       241 TCAGCTCCCTGCCCTACTTGGCCATGTGGCTCTNTCTCCATGTTCATCTCGGTGGTCGCC 300
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
8098R-2.in silico     241 TCAGCTCCCTGCCCTACTTGGCCATGTGGCTCT-TCTCCATGTTCATCTCGGTGGTCGCC 300


8098R-2.IR_full       301 GATTGGATGATTAGCTCGAAGAGATTCTCNGCACACGGCCACCAGGAAGCTGATCAACAG 360
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
8098R-2.in silico     301 GATTGGATGATTAGCTCGAAGAGATTCTC-GCACACGGCCACCAGGAAGCTGATCAACAG 360


8098R-2.IR_full       361 TATTGGCCAGTATGGACCGGGAGTCGCCCTAATCGCCGCCTCCTACACGGGCTGCGACAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8098R-2.in silico     361 TATTGGCCAGTATGGACCGGGAGTCGCCCTAATCGCCGCCTCCTACACGGGCTGCGACAG 420


8098R-2.IR_full       421 AGCACTGACCTTGGCCATCCTCACCATCGGAGTGGGTCTTAATGGAGGTATCTACTCCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8098R-2.in silico     421 AGCACTGACCTTGGCCATCCTCACCATCGGAGTGGGTCTTAATGGAGGTATCTACTCCGG 480


8098R-2.IR_full       481 CTTCAAGATCAACCACTTGGACC 503
                          |||||||||||||||||||||||
8098R-2.in silico     481 CTTCAAGATCAACCACTTGGACC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137302.2  CG8098-RA, transcript variant A (Picot), mRNA 
100   482  NM_166187.1  CG8098-RB, transcript variant B (Picot), mRNA 
0.82   NM_132629.1  CG4330-RA (CG4330), mRNA 
0.2   18  NM_134728.1  CG4726-RA (CG4726), mRNA 
0   19  28  NM_131960.1  CG6978-RA (CG6978), mRNA 
0   NM_206202.1  CG9826-RB, transcript variant B (CG9826), mRNA 
0   NM_137880.1  CG9826-RA, transcript variant A (CG9826), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_176747.1  CG5424-RE, transcript variant E (f), mRNA 
0   NM_167563.2  CG5424-RA, transcript variant A (f), mRNA 
0   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   NM_142560.2  CG17752-RA (CG17752), mRNA 
0   NM_141784.2  CG6629-RA (CG6629), mRNA 
0   NM_135767.1  CG5682-RA (CG5682), mRNA 
0   NM_133013.1  CG15816-RA (CG15816), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_136652.2  CG1809-RA (CG1809), mRNA 
0   NM_079060.2  CG17725-RA, transcript variant A (Pepck), mRNA 
0   NM_166293.1  CG17725-RB, transcript variant B (Pepck), mRNA 
0   NM_136426.2  CG1707-RA (CG1707), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.