National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8086R-3 
 Symbol CG8086  Full Name CG8086 
 CG No CG8086  Old CG No CG8086 
 Synonyms CG8113, CG8086 
 Accession No (Link to NCBI) NM_170611.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTACAATGTTACGGGTATGCG 
 Primer Seq. 3'
aatctagaggtaccTGCCAAAGGATATGGCAGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTACAATGTT ACGGGTATGC GAGCCAAGGG TCGGGATTAT CCTCGAGCAG CCACTCTGCA 
0061 GAGCAGNCCC AAGGAACTAA CACGCTTCTC GAATCCCGGA CCTGGGGAAT ACGATGTGGT 
0121 GCCGGCGGcC ANAGGCGGTG ATCGATGCCA CGCCCAAATA CACTTTTGGC CAACGGCCGG 
0181 TCGCGTTGAA AACCTTCCAG ATACCAGCTC CTAATGTCTA CAAAATACCG ACCGTCATGG 
0241 GCAGCAGCAA GGAGGGCAAG ATTCGTTCGG CTCCGGCTTA TACGATTACG GGTCGGGAGA 
0301 AGCCTCCGCT GATTCCGGTG ATGATCTTCC CCGGACCCGG TTACTACGAC GGCGAGTACA 
0361 CGGTGGTCAA ACCAAAGCCA CCAGTCTTCT CCATgCGCGG CAAGTACAAG ATGGGCAGCG 
0421 AGGACTCGAA GcCCGGACCC GGAGCGCACT GTCCGGAGAA GTACTGGGAG AAACGTTCGC 
0481 CTNCTGCCAT ATNCTTTGGC A 
 in silico PCR Fragment
0001 GTACAATGTT ACGGGTATGC GAGCCAAGGG TCGGGATTAT CCTCGAGCAG CCACTCTGCA 
0061 GAGCAGACCC AAGGAACTAA CACGCTTCTC GAATCCCGGA CCTGGGGAAT ACGATGTGGT 
0121 GCCGGCGGCC A-AGGCGGTG ATCGATGCCA CGCCCAAATA CACTTTTGGC CAACGGCCGG 
0181 TCGCGTTGAA AACCTTCCAG ATACCAGCTC CTAATGTCTA CAAAATACCG ACCGTCATGG 
0241 GCAGCAGCAA GGAGGGCAAG ATTCGTTCGG CTCCGGCTTA TACGATTACG GGTCGGGAGA 
0301 AGCCTCCGCT GATTCCGGTG ATGATCTTCC CCGGACCCGG TTACTACGAC GGCGAGTACA 
0361 CGGTGGTCAA ACCAAAGCCA CCAGTCTTCT CCATGCGCGG CAAGTACAAG ATGGGCAGCG 
0421 AGGACTCGAA GCCCGGACCC GGAGCGCACT GTCCGGAGAA GTACTGGGAG AAACGTTCGC 
0481 CTCCTGCCAT ATCCTTTGGC A 
 Assemble Data

8086R-3.IR_full       1   GTACAATGTTACGGGTATGCGAGCCAAGGGTCGGGATTATCCTCGAGCAGCCACTCTGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     1   GTACAATGTTACGGGTATGCGAGCCAAGGGTCGGGATTATCCTCGAGCAGCCACTCTGCA 60


8086R-3.IR_full       61  GAGCAGNCCCAAGGAACTAACACGCTTCTCGAATCCCGGACCTGGGGAATACGATGTGGT 120
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     61  GAGCAGACCCAAGGAACTAACACGCTTCTCGAATCCCGGACCTGGGGAATACGATGTGGT 120


8086R-3.IR_full       121 GCCGGCGGCCANAGGCGGTGATCGATGCCACGCCCAAATACACTTTTGGCCAACGGCCGG 180
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     121 GCCGGCGGCCA-AGGCGGTGATCGATGCCACGCCCAAATACACTTTTGGCCAACGGCCGG 180


8086R-3.IR_full       181 TCGCGTTGAAAACCTTCCAGATACCAGCTCCTAATGTCTACAAAATACCGACCGTCATGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     181 TCGCGTTGAAAACCTTCCAGATACCAGCTCCTAATGTCTACAAAATACCGACCGTCATGG 240


8086R-3.IR_full       241 GCAGCAGCAAGGAGGGCAAGATTCGTTCGGCTCCGGCTTATACGATTACGGGTCGGGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     241 GCAGCAGCAAGGAGGGCAAGATTCGTTCGGCTCCGGCTTATACGATTACGGGTCGGGAGA 300


8086R-3.IR_full       301 AGCCTCCGCTGATTCCGGTGATGATCTTCCCCGGACCCGGTTACTACGACGGCGAGTACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     301 AGCCTCCGCTGATTCCGGTGATGATCTTCCCCGGACCCGGTTACTACGACGGCGAGTACA 360


8086R-3.IR_full       361 CGGTGGTCAAACCAAAGCCACCAGTCTTCTCCATGCGCGGCAAGTACAAGATGGGCAGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     361 CGGTGGTCAAACCAAAGCCACCAGTCTTCTCCATGCGCGGCAAGTACAAGATGGGCAGCG 420


8086R-3.IR_full       421 AGGACTCGAAGCCCGGACCCGGAGCGCACTGTCCGGAGAAGTACTGGGAGAAACGTTCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8086R-3.in silico     421 AGGACTCGAAGCCCGGACCCGGAGCGCACTGTCCGGAGAAGTACTGGGAGAAACGTTCGC 480


8086R-3.IR_full       481 CTNCTGCCATATNCTTTGGCA 501
                          || ||||||||| ||||||||
8086R-3.in silico     481 CTCCTGCCATATCCTTTGGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170611.1  CG8086-RA, transcript variant A (CG8086), mRNA 
100   482  NM_057879.3  CG8086-RB, transcript variant B (CG8086), mRNA 
90.24   435  13  NM_205928.1  CG8086-RD, transcript variant D (CG8086), mRNA 
41.9   202  NM_205929.1  CG8086-RC, transcript variant C (CG8086), mRNA 
0   NM_001038986.1  CG1721-RC, transcript variant C (Pglym78), mRNA 
0   NM_001038987.1  CG1721-RB, transcript variant B (Pglym78), mRNA 
0   NM_079822.2  CG1721-RA, transcript variant A (Pglym78), mRNA 
0   NM_168420.1  CG32067-RA, transcript variant A (simj), mRNA 
0   NM_140150.2  CG32067-RC, transcript variant C (simj), mRNA 
0   NM_168421.1  CG32067-RB, transcript variant B (simj), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_136835.2  CG9035-RA (Tapdelta), mRNA 
0   NM_132946.2  CG9104-RA (CG9104), mRNA 
0   NM_143010.1  CG13623-RA (CG13623), mRNA 
0   NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_132686.2  CG32627-RA, transcript variant A (CG32627), mRNA 
0   NM_167379.1  CG32627-RB, transcript variant B (CG32627), mRNA 
0   NM_176726.1  CG32627-RC, transcript variant C (CG32627), mRNA 
0   NM_130545.2  CG11411-RA (fs(1)N), mRNA 
0   NM_079298.2  CG7636-RA (mRpL2), mRNA 
0   NM_143349.1  CG4869-RA (betaTub97EF), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_134873.1  CG3119-RA, transcript variant A (CG3119), mRNA 
0   NM_143483.1  CG7808-RC (RpS8), mRNA 
0   NM_133149.2  CG8051-RA (CG8051), mRNA 
0   NM_132881.2  CG3415-RA (CG3415), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.