National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8070R-2 
 Symbol Mys45A  Full Name Mystery 45A 
 CG No CG8070  Old CG No CG8070 
 Synonyms CG8070, anon-WO0118547.170, Mys45A 
 Accession No (Link to NCBI) NM_136611.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGCAGTTGCAGAACCTCATCAAGCGGGATCCGGAGTCGTATAGCGATGAGTTCCACATC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGTACCAACACTTTCTTAGCTTGCTGGAAGTTTTTGCGCTGAATCCCAGCGAAGAAAAC 120

                          ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     121 AAATCCCTGGATGACATCGTCATGTTT-GTCGCCCAGGTGGCTCAGTGCTATCCGGCCGT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGCGAGGAGTTCCCAAAGCGTCTTTCCGATTTGCTGAAGAACTATGCCACCGTTCTGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCCGGCTATGCGTAACTGCTTTGTGAAAGCTCTAATCCTGCTGAGAAACAAGAACCTAGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCCGCGCTGGACATACTGGAACTGTTCTTTCAGTTGCTGCGGTGTCCGGACAAGAATCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGCACCTTTCTGCAAACGCACATTGTGACGGACATCAAGAATATGAATGCCAAGCACAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGACATGAAGCTCAATTCGAGCCTGCAGGCATTCATGTACTCCATGCTGAAGGATGCCAA 480

8070R-2.IR_full       481 TCCGAAGGCAGCCAAGATGTC 501
                          ||||||||||||||||||||| silico     481 TCCGAAGGCAGCCAAGATGTC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136611.2  CG8070-RA (Mys45A), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_142571.1  CG6300-RA (CG6300), mRNA 
0   NM_142572.1  CG11659-RA (CG11659), mRNA 
0   NM_140170.1  CG14145-RA (CG14145), mRNA 
0   NM_079924.2  CG18780-RA (MED20), mRNA 
0   NM_134682.2  CG4133-RA (CG4133), mRNA 
0   NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0   NM_135801.2  CG9302-RA (CG9302), mRNA 
0   NM_141887.1  CG3532-RA (CG3532), mRNA 
0   NM_079303.2  CG7303-RA (Gr68a), mRNA 
0   NM_139810.2  CG9953-RA (CG9953), mRNA 
0   NM_079056.2  CG5784-RB, transcript variant B (Mapmodulin), mRNA 
0   NM_166258.1  CG5784-RA, transcript variant A (Mapmodulin), mRNA 
0   NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 
0   NM_001014720.1  CG3620-RD, transcript variant D (norpA), mRNA 
0   NM_169906.1  CG4217-RB, transcript variant B (TFAM), mRNA 
0   NM_079691.2  CG4217-RA, transcript variant A (TFAM), mRNA 
0   NM_136623.1  CG8014-RA (Rme-8), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_079615.2  CG7756-RA (Hsc70-2), mRNA 
0   NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0   NM_176065.1  CG1864-RC, transcript variant C (Hr38), mRNA 
0   NM_142083.2  CG14355-RA (CG14355), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.