National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8070R-1 
 Symbol Mys45A  Full Name Mystery 45A 
 CG No CG8070  Old CG No CG8070 
 Synonyms CG8070, anon-WO0118547.170, Mys45A 
 Accession No (Link to NCBI) NM_136611.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Park SH, Lee CW, Lee JH, Park JY, Roshandell M, Brennan CA, Choe KM.
Requirement for and polarized localization of integrin proteins during Drosophila wound closure.
Mol. Biol. Cell (2018) 29(18) 2137-2147 [ PubMed ID = 29995573 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCAGTTGCAGAACCTCATC 
 Primer Seq. 3'
aatctagaggtaccGACATCTTGGCTGCCTTCGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGCAGTTGC AGAACCTCAT CAAGCGGGAT CCGGAGTCGT ATAGCGATGA GTTCCACATC 
0061 CAGTACCAAC ACTTTCTTAG CTTGCTGGAA GTTTTTGCGC TGAATCCCAG CGAAGAAAAC 
0121 AAATCCCTGG ATGACATCGT CATGTTTNGT CGCCCAGGTG GCTCAGTGCT ATCCGGCCGT 
0181 CTGCGAGGAG TTCCCAAAGC GTCTTTCCGA TTTGCTGAAG AACTATGCCA CCGTTCTGGA 
0241 CCCGGCTATG CGTAACTGCT TTGTGAAAGC TCTAATCCTG CTGAGAAACA AGAACCTAGT 
0301 GCCCGCGCTG GACATACTGG AACTGTTCTT TCAGTTGCTG CGGTGTCCGG ACAAGAATCT 
0361 GCGCACCTTT CTGCAAACGC ACATTGTGAC GGACATCAAG AATATGAATG CCAAGCACAA 
0421 GGACATGAAG CTCAATTCGA GCCTGCAGGC ATTCATGTAC TCCATGCTGA AGGATGCCAA 
0481 TCCGAAGGCA GCCAAGATGT C 
 in silico PCR Fragment
0001 CCGCAGTTGC AGAACCTCAT CAAGCGGGAT CCGGAGTCGT ATAGCGATGA GTTCCACATC 
0061 CAGTACCAAC ACTTTCTTAG CTTGCTGGAA GTTTTTGCGC TGAATCCCAG CGAAGAAAAC 
0121 AAATCCCTGG ATGACATCGT CATGTTT-GT CGCCCAGGTG GCTCAGTGCT ATCCGGCCGT 
0181 CTGCGAGGAG TTCCCAAAGC GTCTTTCCGA TTTGCTGAAG AACTATGCCA CCGTTCTGGA 
0241 CCCGGCTATG CGTAACTGCT TTGTGAAAGC TCTAATCCTG CTGAGAAACA AGAACCTAGT 
0301 GCCCGCGCTG GACATACTGG AACTGTTCTT TCAGTTGCTG CGGTGTCCGG ACAAGAATCT 
0361 GCGCACCTTT CTGCAAACGC ACATTGTGAC GGACATCAAG AATATGAATG CCAAGCACAA 
0421 GGACATGAAG CTCAATTCGA GCCTGCAGGC ATTCATGTAC TCCATGCTGA AGGATGCCAA 
0481 TCCGAAGGCA GCCAAGATGT C 
 Assemble Data

8070R-1.IR_full       1   CCGCAGTTGCAGAACCTCATCAAGCGGGATCCGGAGTCGTATAGCGATGAGTTCCACATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     1   CCGCAGTTGCAGAACCTCATCAAGCGGGATCCGGAGTCGTATAGCGATGAGTTCCACATC 60


8070R-1.IR_full       61  CAGTACCAACACTTTCTTAGCTTGCTGGAAGTTTTTGCGCTGAATCCCAGCGAAGAAAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     61  CAGTACCAACACTTTCTTAGCTTGCTGGAAGTTTTTGCGCTGAATCCCAGCGAAGAAAAC 120


8070R-1.IR_full       121 AAATCCCTGGATGACATCGTCATGTTTNGTCGCCCAGGTGGCTCAGTGCTATCCGGCCGT 180
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8070R-1.in silico     121 AAATCCCTGGATGACATCGTCATGTTT-GTCGCCCAGGTGGCTCAGTGCTATCCGGCCGT 180


8070R-1.IR_full       181 CTGCGAGGAGTTCCCAAAGCGTCTTTCCGATTTGCTGAAGAACTATGCCACCGTTCTGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     181 CTGCGAGGAGTTCCCAAAGCGTCTTTCCGATTTGCTGAAGAACTATGCCACCGTTCTGGA 240


8070R-1.IR_full       241 CCCGGCTATGCGTAACTGCTTTGTGAAAGCTCTAATCCTGCTGAGAAACAAGAACCTAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     241 CCCGGCTATGCGTAACTGCTTTGTGAAAGCTCTAATCCTGCTGAGAAACAAGAACCTAGT 300


8070R-1.IR_full       301 GCCCGCGCTGGACATACTGGAACTGTTCTTTCAGTTGCTGCGGTGTCCGGACAAGAATCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     301 GCCCGCGCTGGACATACTGGAACTGTTCTTTCAGTTGCTGCGGTGTCCGGACAAGAATCT 360


8070R-1.IR_full       361 GCGCACCTTTCTGCAAACGCACATTGTGACGGACATCAAGAATATGAATGCCAAGCACAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     361 GCGCACCTTTCTGCAAACGCACATTGTGACGGACATCAAGAATATGAATGCCAAGCACAA 420


8070R-1.IR_full       421 GGACATGAAGCTCAATTCGAGCCTGCAGGCATTCATGTACTCCATGCTGAAGGATGCCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8070R-1.in silico     421 GGACATGAAGCTCAATTCGAGCCTGCAGGCATTCATGTACTCCATGCTGAAGGATGCCAA 480


8070R-1.IR_full       481 TCCGAAGGCAGCCAAGATGTC 501
                          |||||||||||||||||||||
8070R-1.in silico     481 TCCGAAGGCAGCCAAGATGTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136611.2  CG8070-RA (Mys45A), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_142571.1  CG6300-RA (CG6300), mRNA 
0   NM_142572.1  CG11659-RA (CG11659), mRNA 
0   NM_140170.1  CG14145-RA (CG14145), mRNA 
0   NM_079924.2  CG18780-RA (MED20), mRNA 
0   NM_134682.2  CG4133-RA (CG4133), mRNA 
0   NM_176723.2  CG33175-RG, transcript variant G (spri), mRNA 
0   NM_135801.2  CG9302-RA (CG9302), mRNA 
0   NM_141887.1  CG3532-RA (CG3532), mRNA 
0   NM_079303.2  CG7303-RA (Gr68a), mRNA 
0   NM_139810.2  CG9953-RA (CG9953), mRNA 
0   NM_079056.2  CG5784-RB, transcript variant B (Mapmodulin), mRNA 
0   NM_166258.1  CG5784-RA, transcript variant A (Mapmodulin), mRNA 
0   NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 
0   NM_001014720.1  CG3620-RD, transcript variant D (norpA), mRNA 
0   NM_169906.1  CG4217-RB, transcript variant B (TFAM), mRNA 
0   NM_079691.2  CG4217-RA, transcript variant A (TFAM), mRNA 
0   NM_136623.1  CG8014-RA (Rme-8), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_079615.2  CG7756-RA (Hsc70-2), mRNA 
0   NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0   NM_176065.1  CG1864-RC, transcript variant C (Hr38), mRNA 
0   NM_142083.2  CG14355-RA (CG14355), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.