National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8069R-1 
 Symbol Phax  Full Name Phosphorylated adaptor for RNA export 
 CG No CG8069  Old CG No CG8069 
 Synonyms CG8069, dPHAX, BEST:GH22533, Phax 
 Accession No (Link to NCBI) NM_136612.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTGCACGCAAATGACGTTGA 
 Primer Seq. 3'
aatctagaggtaccTTGAGAGTCGTCGCTTTAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTGCACGCA AATGACGTTG ACCTGGAGGA CGGCGAGCTA TCGGAGAGCG ACGATGATGG 
0061 CGTTTACACG CCGTTGCAAG CGACCTGACG GTGCGGAGAA GGTGGCCAGT CCCCTTACCA 
0121 CCTGCCATCA GATCCAGACT GCGTTAGAGG ACGAGTCACA AAGCAACAGC GACCTCCTCG 
0181 ACTGCCGAAT CCTCCGAGGA CGGGTGCATC AAGAAGCTTC GTACGGAATC CACCGGACCC 
0241 GACGGCCACA AGAAGCGGAA AAAGCGCATT CGGCGACACG GTAATNGCGg cGCGTTCCGC 
0301 CCACGGATGC TGAAATGCAA CCGAATCGAG CCCGTTTCAA GAAGTACAAC GTGTGGGCTT 
0361 CTGCCCTGCA AGAGGATGCG CTCAGCGAGA ATATGCGTGG CTGCGACGTT ACCCGAAGCG 
0421 GTCGGGATCG AAATGTTGAA AACTACGACT TCTCATTGCG ATACCGGCTG AACGGCGAGA 
0481 ACACTCTAAA GCGACGACTC TCAA 
 in silico PCR Fragment
0001 ACTGCACGCA AATGACGTTG ACCTGGAGGA CGGCGAGCTA TCGGAGAGCG ACGATGATGG 
0061 CGTTTACACG CCGTTGC-AG CGACCTGACG GTGCGGAGAA GGTGGCCAGT CCCCTTACCA 
0121 CCTGCCATCA GATCCAGACT GCGTTAGAGG ACGAGTCACA AAGCAACAGC GA-CTCCTCG 
0181 ACTGCCGAAT CCTCCGAGGA CGGGTGCATC AAGAAGCTTC GTACGGAATC CACCGGACCC 
0241 GACGGCCACA AGAAGCGGAA AAAGCGCATT CGGCG-CACG GTAAT-GCGG CGCGTTCCGC 
0301 CCACGGATGC TGAAATGCAA CCGAATCGAG CCCGTTTCAA GAAGTACAAC GTGTGGGCTT 
0361 CTGCCCTGCA AGAGGATGCG CTCAGCGAGA ATATGCGTGG CTGCGACGTT ACCCGAAGCG 
0421 GTCGGGATCG AAATGTTGAA AACTACGACT TCTCATTGCG ATACCGGCTG AACGGCGAGA 
0481 ACACTCTAAA GCGACGACTC TCAA 
 Assemble Data

8069R-1.IR_full       1   ACTGCACGCAAATGACGTTGACCTGGAGGACGGCGAGCTATCGGAGAGCGACGATGATGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8069R-1.in silico     1   ACTGCACGCAAATGACGTTGACCTGGAGGACGGCGAGCTATCGGAGAGCGACGATGATGG 60


8069R-1.IR_full       61  CGTTTACACGCCGTTGCAAGCGACCTGACGGTGCGGAGAAGGTGGCCAGTCCCCTTACCA 120
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8069R-1.in silico     61  CGTTTACACGCCGTTGC-AGCGACCTGACGGTGCGGAGAAGGTGGCCAGTCCCCTTACCA 120


8069R-1.IR_full       121 CCTGCCATCAGATCCAGACTGCGTTAGAGGACGAGTCACAAAGCAACAGCGACCTCCTCG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
8069R-1.in silico     121 CCTGCCATCAGATCCAGACTGCGTTAGAGGACGAGTCACAAAGCAACAGCGA-CTCCTCG 180


8069R-1.IR_full       181 ACTGCCGAATCCTCCGAGGACGGGTGCATCAAGAAGCTTCGTACGGAATCCACCGGACCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8069R-1.in silico     181 ACTGCCGAATCCTCCGAGGACGGGTGCATCAAGAAGCTTCGTACGGAATCCACCGGACCC 240


8069R-1.IR_full       241 GACGGCCACAAGAAGCGGAAAAAGCGCATTCGGCGACACGGTAATNGCGGCGCGTTCCGC 300
                          ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||
8069R-1.in silico     241 GACGGCCACAAGAAGCGGAAAAAGCGCATTCGGCG-CACGGTAAT-GCGGCGCGTTCCGC 300


8069R-1.IR_full       301 CCACGGATGCTGAAATGCAACCGAATCGAGCCCGTTTCAAGAAGTACAACGTGTGGGCTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8069R-1.in silico     301 CCACGGATGCTGAAATGCAACCGAATCGAGCCCGTTTCAAGAAGTACAACGTGTGGGCTT 360


8069R-1.IR_full       361 CTGCCCTGCAAGAGGATGCGCTCAGCGAGAATATGCGTGGCTGCGACGTTACCCGAAGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8069R-1.in silico     361 CTGCCCTGCAAGAGGATGCGCTCAGCGAGAATATGCGTGGCTGCGACGTTACCCGAAGCG 420


8069R-1.IR_full       421 GTCGGGATCGAAATGTTGAAAACTACGACTTCTCATTGCGATACCGGCTGAACGGCGAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8069R-1.in silico     421 GTCGGGATCGAAATGTTGAAAACTACGACTTCTCATTGCGATACCGGCTGAACGGCGAGA 480


8069R-1.IR_full       481 ACACTCTAAAGCGACGACTCTCAA 504
                          ||||||||||||||||||||||||
8069R-1.in silico     481 ACACTCTAAAGCGACGACTCTCAA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   540  NM_165644.1  CG8069-RB, transcript variant B (Phax), mRNA 
86.29   466  NM_136612.2  CG8069-RA, transcript variant A (Phax), mRNA 
0   NM_080323.2  CG10798-RA (dm), mRNA 
0   NM_057440.3  CG7811-RA (b), mRNA 
0   NM_168268.1  CG7176-RE, transcript variant E (Idh), mRNA 
0   NM_168266.1  CG7176-RD, transcript variant D (Idh), mRNA 
0   NM_143787.2  CG7176-RC, transcript variant C (Idh), mRNA 
0   NM_168265.1  CG7176-RB, transcript variant B (Idh), mRNA 
0   NM_176298.1  CG7176-RG, transcript variant G (Idh), mRNA 
0   NM_168267.1  CG7176-RA, transcript variant A (Idh), mRNA 
0   NM_168269.1  CG7176-RF, transcript variant F (Idh), mRNA 
0   NM_141042.1  CG7663-RA (CG7663), mRNA 
0   NM_168497.1  CG32105-RB (CG32105), mRNA 
0   NM_169523.1  CG14374-RA (CG14374), mRNA 
0   NM_132083.3  CG3815-RA (CG3815), mRNA 
0   NM_079760.2  CG6593-RA (Pp1alpha-96A), mRNA 
0   NM_206230.1  CG32318-RA (CG32318), mRNA 
0   NM_138242.1  CG9187-RA (Psf1), mRNA 
0   NM_138055.1  CG30419-RA (CG30419), mRNA 
0   21  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_001032034.1  CG5501-RH, transcript variant H (Myo95E), mRNA 
0   NM_206117.1  CG10265-RB, transcript variant B (CG10265), mRNA 
0   NM_001032036.1  CG5501-RF, transcript variant F (Myo95E), mRNA 
0   NM_206555.1  CG5501-RD, transcript variant D (Myo95E), mRNA 
0   NM_206556.1  CG5501-RB, transcript variant B (Myo95E), mRNA 
0   NM_001032037.1  CG5501-RE, transcript variant E (Myo95E), mRNA 
0   NM_001032035.1  CG5501-RG, transcript variant G (Myo95E), mRNA 
0   NM_001032033.1  CG5501-RI, transcript variant I (Myo95E), mRNA 
0   NM_132103.2  CG3973-RA (CG3973), mRNA 
0   NM_169562.1  CG3028-RA (Ipp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.