National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8068R-1 
 Symbol Su(var)2-10  Full Name Suppressor of variegation 2-10 
 CG No CG8068  Old CG No CG8068 
 Synonyms dPIAS, ZimpB, Su(Var)2-10, zimp, DPIAS, PIAS, i184, CG8068, dpias, ZimpA, Dpias, l(2)03697, CLOT2057, Suvar(2)10, Su-var(2)10, Su(var)2-10, ZIMP 
 Accession No (Link to NCBI) NM_078940.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCGAGCTGCAAAAAATCCTG 
 Primer Seq. 3'
aatctagaggtaccCGATTAGAGGCAATCTCGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCGAGCTGC AAAAAATCCT GTCGTTTCTG AACATCTCAT TCGCTGGACG AAAAACTGAC 
0061 CTGCAGAGCC GCATCCTCTC GTTCTTGCGC ACCAACTTGG AACTGCTTGC CCCGAAGGTC 
0121 CAGGAAGTCT ACGCCCAGTC CGTGCAGGAA CAAANACGCC ACGCTGCAGT ACATCGACCC 
0181 AACCAGGATG TACTCGCACA TCCAGCTGCC GCCCACCGTG CAGCCCAATC CCGTGGGCCT 
0241 CGTGGGCAGC GGCCAAGGTG TGCAAGTGCC CGGCGGCCAG ATGAATGTGG TCGGCGGCGC 
0301 ACCCTTCCTC CACACACACA GCATCAACAG CCAGCTGCCT ATTCACCCCG ATGTGCGGCT 
0361 GAAAAAGCTA GCCTTCTACG ATGTACTCGG AACGCTAATT AAGCCTTCAA CTCTGGTGCC 
0421 ACGCAACACT CAGCGCGTCC AAGAGGTGCC TTTCTACTTN CACGCTCACG CCGCAGCAGG 
0481 CCACCGAGAT TGCCTCTAAT CG 
 in silico PCR Fragment
0001 GTCGAGCTGC AAAAAATCCT GTCGTTTCTG AACATCTCAT TCGCTGGACG AAAAACTGAC 
0061 CTGCAGAGCC GCATCCTCTC GTTCTTGCGC ACCAACTTGG AACTGCTTGC CCCGAAGGTC 
0121 CAGGAAGTCT ACGCCCAGTC CGTGCAGGAA CAAA-ACGCC ACGCTGCAGT ACATCGACCC 
0181 AACCAGGATG TACTCGCACA TCCAGCTGCC GCCCACCGTG CAGCCCAATC CCGTGGGCCT 
0241 CGTGGGCAGC GGCCAAGGTG TGCAAGTGCC CGGCGGCCAG ATGAATGTGG TCGGCGGCGC 
0301 ACCCTTCCTC CACACACACA GCATCAACAG CCAGCTGCCT ATTCACCCCG ATGTGCGGCT 
0361 GAAAAAGCTA GCCTTCTACG ATGTACTCGG AACGCTAATT AAGCCTTCAA CTCTGGTGCC 
0421 ACGCAACACT CAGCGCGTCC AAGAGGTGCC TTTCTACTT- CACGCTCACG CCGCAGCAGG 
0481 CCACCGAGAT TGCCTCTAAT CG 
 Assemble Data

8068R-1.IR_full        1   TCGAGCTGCAAAAAATCCTGTCGTTTCTGAACATCTCATTCGCTGGACGAAAAACTGAC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8068R-1.in silico      1   TCGAGCTGCAAAAAATCCTGTCGTTTCTGAACATCTCATTCGCTGGACGAAAAACTGAC 59


8068R-1.IR_full       61  CTGCAGAGCCGCATCCTCTCGTTCTTGCGCACCAACTTGGAACTGCTTGCCCCGAAGGTC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8068R-1.in silico     61  CTGCAGAGCCGCATCCTCTCGTTCTTGCGCACCAACTTGGAACTGCTTGCCCCGAAGGTC 119


8068R-1.IR_full       121 CAGGAAGTCTACGCCCAGTCCGTGCAGGAACAAANACGCCACGCTGCAGTACATCGACCC 179
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
8068R-1.in silico     121 CAGGAAGTCTACGCCCAGTCCGTGCAGGAACAAA-ACGCCACGCTGCAGTACATCGACCC 179


8068R-1.IR_full       181 AACCAGGATGTACTCGCACATCCAGCTGCCGCCCACCGTGCAGCCCAATCCCGTGGGCCT 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8068R-1.in silico     181 AACCAGGATGTACTCGCACATCCAGCTGCCGCCCACCGTGCAGCCCAATCCCGTGGGCCT 239


8068R-1.IR_full       241 CGTGGGCAGCGGCCAAGGTGTGCAAGTGCCCGGCGGCCAGATGAATGTGGTCGGCGGCGC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8068R-1.in silico     241 CGTGGGCAGCGGCCAAGGTGTGCAAGTGCCCGGCGGCCAGATGAATGTGGTCGGCGGCGC 299


8068R-1.IR_full       301 ACCCTTCCTCCACACACACAGCATCAACAGCCAGCTGCCTATTCACCCCGATGTGCGGCT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8068R-1.in silico     301 ACCCTTCCTCCACACACACAGCATCAACAGCCAGCTGCCTATTCACCCCGATGTGCGGCT 359


8068R-1.IR_full       361 GAAAAAGCTAGCCTTCTACGATGTACTCGGAACGCTAATTAAGCCTTCAACTCTGGTGCC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8068R-1.in silico     361 GAAAAAGCTAGCCTTCTACGATGTACTCGGAACGCTAATTAAGCCTTCAACTCTGGTGCC 419


8068R-1.IR_full       421 ACGCAACACTCAGCGCGTCCAAGAGGTGCCTTTCTACTTNCACGCTCACGCCGCAGCAGG 479
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
8068R-1.in silico     421 ACGCAACACTCAGCGCGTCCAAGAGGTGCCTTTCTACTT-CACGCTCACGCCGCAGCAGG 479


8068R-1.IR_full       481 CCACCGAGATTGCCTCTAATCG 501
                          ||||||||||||||||||||||
8068R-1.in silico     481 CCACCGAGATTGCCTCTAATCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165645.1  CG8068-RI, transcript variant I (Su(var)2-10), mRNA 
100   482  NM_165647.1  CG8068-RH, transcript variant H (Su(var)2-10), mRNA 
100   482  NM_165646.1  CG8068-RD, transcript variant D (Su(var)2-10), mRNA 
100   482  NM_165648.1  CG8068-RG, transcript variant G (Su(var)2-10), mRNA 
100   482  NM_165650.1  CG8068-RF, transcript variant F (Su(var)2-10), mRNA 
100   482  NM_165649.1  CG8068-RC, transcript variant C (Su(var)2-10), mRNA 
100   482  NM_165651.1  CG8068-RB, transcript variant B (Su(var)2-10), mRNA 
100   482  NM_165652.1  CG8068-RE, transcript variant E (Su(var)2-10), mRNA 
100   482  NM_078940.2  CG8068-RA, transcript variant A (Su(var)2-10), mRNA 
0   NM_141998.1  CG11670-RA (CG11670), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_170244.1  CG17370-RB, transcript variant B (CG17370), mRNA 
0   NM_143180.1  CG17370-RA, transcript variant A (CG17370), mRNA 
0   NM_170245.1  CG17370-RC, transcript variant C (CG17370), mRNA 
0   NM_176508.1  CG3962-RC, transcript variant C (Keap1), mRNA 
0   NM_142337.1  CG3962-RA, transcript variant A (Keap1), mRNA 
0   NM_169744.1  CG3962-RB, transcript variant B (Keap1), mRNA 
0   NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
0   NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0   NM_001014754.1  CG33525-RC, transcript variant C (CG33525), mRNA 
0   NM_001014752.1  CG33525-RF, transcript variant F (CG33525), mRNA 
0   NM_001014753.1  CG33525-RE, transcript variant E (CG33525), mRNA 
0   NM_001014756.1  CG33525-RA, transcript variant A (CG33525), mRNA 
0   NM_001014755.1  CG33525-RD, transcript variant D (CG33525), mRNA 
0   NM_142092.2  CG14840-RA (CG14840), mRNA 
0   NM_137801.2  CG6203-RA, transcript variant A (Fmr1), mRNA 
0   NM_169324.1  CG6203-RC, transcript variant C (Fmr1), mRNA 
0   NM_169325.1  CG6203-RD, transcript variant D (Fmr1), mRNA 
0   NM_169326.1  CG6203-RE, transcript variant E (Fmr1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.