National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8064R-2 
 Symbol CG8064  Full Name CG8064 
 CG No CG8064  Old CG No CG8064 
 Synonyms CG8064 
 Accession No (Link to NCBI) NM_142448.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACCGGGCTATAGACAGCTTT 
 Primer Seq. 3'
aatctagaggtaccTCCTTCGAACAGCTTACCACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACCGGGCTA TAGACAGCTT TAATATCATC ACCTCCGGCC GCGCCAATGT GAACTTTGCC 
0061 GTTGTGGACA AGACAGAGGG TCGATATGTG GCCGCTCCAG CTGCTGAAAA TGTGATCGTG 
0121 TGGGATTTGC GAATGGGCGA NTCGCANAGC TGACGCTGCG CCGCGAAAAG TTCGAGGTCA 
0181 CCTCCCTGAG GGTCTCGCCA GATCACCTGC ACATTGCCGT TGGCTATGCG GATGGCATGG 
0241 TGCAGATCTT CGATCTCAGC TCGGACAGGT ACTACGATCC CATCTGTACG CTGGCACTCC 
0301 ACAAGAACGC TGTTANGCAT CCTGCGGTAC GATTTGCAGG GCATGCGTCT GGTGANGCGG 
0361 AGGCCTGGAC ACCGAATTGG TGGTCGTCGA TGTGGTGGAG CAGGCGGGAA GAGCTCGATT 
0421 GAGTGGCCAC AATGCCGCCA TCACGGACGC CCATTTCCTG CAGCGTCTGG TAGACGAGAG 
0481 CATAGTGGTA AGCTGTTCGA AGGA 
 in silico PCR Fragment
0001 TACCGGGCTA TAGACAGCTT TAATATCATC ACCTCCGGCC GCGCCAATGT GAACTTTGCC 
0061 GTTGTGGACA AGACAGAGGG TCGATATGTG GCCGCTCCAG CTGCTGAAAA TGTGATCGTG 
0121 TGGGATTTGC GAATGGGCGA -TCGCA-AGC TGACGCTGCG CCGCGAAAAG TTCGAGGTCA 
0181 CCTCCCTGAG GGTCTCGCCA GATCACCTGC ACATTGCCGT TGGCTATGCG GATGGCATGG 
0241 TGCAGATCTT CGATCTCAGC TCGGACAGGT ACTACGATCC CATCTGTACG CTGGCACTCC 
0301 ACAAGAACGC TGTTA-GCAT CCTGCGGTAC GATTTGCAGG GCATGCGTCT GGTGA-GCGG 
0361 AGGCCTGGAC ACCGAATTGG TGGTCGTCGA TGTGGTGGAG CAGGCGGGAA GAGCTCGATT 
0421 GAGTGGCCAC AATGCCGCCA TCACGGACGC CCATTTCCTG CAGCGTCTGG TAGACGAGAG 
0481 CATAGTGGTA AGCTGTTCGA AGGA 
 Assemble Data

8064R-2.IR_full       1   TACCGGGCTATAGACAGCTTTAATATCATCACCTCCGGCCGCGCCAATGTGAACTTTGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8064R-2.in silico     1   TACCGGGCTATAGACAGCTTTAATATCATCACCTCCGGCCGCGCCAATGTGAACTTTGCC 60


8064R-2.IR_full       61  GTTGTGGACAAGACAGAGGGTCGATATGTGGCCGCTCCAGCTGCTGAAAATGTGATCGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8064R-2.in silico     61  GTTGTGGACAAGACAGAGGGTCGATATGTGGCCGCTCCAGCTGCTGAAAATGTGATCGTG 120


8064R-2.IR_full       121 TGGGATTTGCGAATGGGCGANTCGCANAGCTGACGCTGCGCCGCGAAAAGTTCGAGGTCA 180
                          |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||
8064R-2.in silico     121 TGGGATTTGCGAATGGGCGA-TCGCA-AGCTGACGCTGCGCCGCGAAAAGTTCGAGGTCA 180


8064R-2.IR_full       181 CCTCCCTGAGGGTCTCGCCAGATCACCTGCACATTGCCGTTGGCTATGCGGATGGCATGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8064R-2.in silico     181 CCTCCCTGAGGGTCTCGCCAGATCACCTGCACATTGCCGTTGGCTATGCGGATGGCATGG 240


8064R-2.IR_full       241 TGCAGATCTTCGATCTCAGCTCGGACAGGTACTACGATCCCATCTGTACGCTGGCACTCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8064R-2.in silico     241 TGCAGATCTTCGATCTCAGCTCGGACAGGTACTACGATCCCATCTGTACGCTGGCACTCC 300


8064R-2.IR_full       301 ACAAGAACGCTGTTANGCATCCTGCGGTACGATTTGCAGGGCATGCGTCTGGTGANGCGG 360
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||
8064R-2.in silico     301 ACAAGAACGCTGTTA-GCATCCTGCGGTACGATTTGCAGGGCATGCGTCTGGTGA-GCGG 360


8064R-2.IR_full       361 AGGCCTGGACACCGAATTGGTGGTCGTCGATGTGGTGGAGCAGGCGGGAAGAGCTCGATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8064R-2.in silico     361 AGGCCTGGACACCGAATTGGTGGTCGTCGATGTGGTGGAGCAGGCGGGAAGAGCTCGATT 420


8064R-2.IR_full       421 GAGTGGCCACAATGCCGCCATCACGGACGCCCATTTCCTGCAGCGTCTGGTAGACGAGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8064R-2.in silico     421 GAGTGGCCACAATGCCGCCATCACGGACGCCCATTTCCTGCAGCGTCTGGTAGACGAGAG 480


8064R-2.IR_full       481 CATAGTGGTAAGCTGTTCGAAGGA 504
                          ||||||||||||||||||||||||
8064R-2.in silico     481 CATAGTGGTAAGCTGTTCGAAGGA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142448.2  CG8064-RA (CG8064), mRNA 
0.41   NM_169827.1  CG31231-RA (CG31231), mRNA 
0   NM_139396.3  CG2069-RA (Oseg4), mRNA 
0   NM_138121.2  CG16932-RA, transcript variant A (Eps-15), mRNA 
0   NM_166686.1  CG16932-RC, transcript variant C (Eps-15), mRNA 
0   NM_166687.1  CG16932-RB, transcript variant B (Eps-15), mRNA 
0   NM_134791.2  CG7289-RA (CG7289), mRNA 
0   NM_136783.2  CG30020-RA (CG30020), mRNA 
0   NM_167667.1  CG14217-RB, transcript variant B (Tao-1), mRNA 
0   NM_134475.2  CG14217-RA, transcript variant A (Tao-1), mRNA 
0   NM_167666.1  CG14217-RE, transcript variant E (Tao-1), mRNA 
0   NM_167665.1  CG14217-RD, transcript variant D (Tao-1), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_143030.2  CG18410-RA (CG18410), mRNA 
0   NM_168144.1  CG32409-RA (CG32409), mRNA 
0   NM_133049.1  CG5988-RA (upd2), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   NM_206479.1  CG5196-RB, transcript variant B (CG5196), mRNA 
0   NM_141934.1  CG5196-RA, transcript variant A (CG5196), mRNA 
0   10  NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_057918.3  CG8048-RA, transcript variant A (Vha44), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.