National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8064R-1 
 Symbol CG8064  Full Name CG8064 
 CG No CG8064  Old CG No CG8064 
 Synonyms CG8064 
 Accession No (Link to NCBI) NM_142448.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TACCGGGCTATAGACAGCTTTAATATCATCACCTCCGGCCGCGCCAATGTGAACTTTGCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTTGTGGACAAGACAGAGGGTCGATATGTGGCCGCTCCAGCTGCTGAAAATGTGATCGTG 120

                          |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| silico     121 TGGGATTTGCGAATGGGCGA-TCGCA-AGCTGACGCTGCGCCGCGAAAAGTTCGAGGTCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCTCCCTGAGGGTCTCGCCAGATCACCTGCACATTGCCGTTGGCTATGCGGATGGCATGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCAGATCTTCGATCTCAGCTCGGACAGGTACTACGATCCCATCTGTACGCTGGCACTCC 300

                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| silico     301 ACAAGAACGCTGTTA-GCATCCTGCGGTACGATTTGCAGGGCATGCGTCTGGTGA-GCGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGCCTGGACACCGAATTGGTGGTCGTCGATGTGGTGGAGCAGGCGGGAAGAGCTCGATT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGTGGCCACAATGCCGCCATCACGGACGCCCATTTCCTGCAGCGTCTGGTAGACGAGAG 480

8064R-1.IR_full       481 CATAGTGGTAAGCTGTTCGAAGGA 504
                          |||||||||||||||||||||||| silico     481 CATAGTGGTAAGCTGTTCGAAGGA 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142448.2  CG8064-RA (CG8064), mRNA 
0.41   NM_169827.1  CG31231-RA (CG31231), mRNA 
0   NM_139396.3  CG2069-RA (Oseg4), mRNA 
0   NM_138121.2  CG16932-RA, transcript variant A (Eps-15), mRNA 
0   NM_166686.1  CG16932-RC, transcript variant C (Eps-15), mRNA 
0   NM_166687.1  CG16932-RB, transcript variant B (Eps-15), mRNA 
0   NM_134791.2  CG7289-RA (CG7289), mRNA 
0   NM_136783.2  CG30020-RA (CG30020), mRNA 
0   NM_167667.1  CG14217-RB, transcript variant B (Tao-1), mRNA 
0   NM_134475.2  CG14217-RA, transcript variant A (Tao-1), mRNA 
0   NM_167666.1  CG14217-RE, transcript variant E (Tao-1), mRNA 
0   NM_167665.1  CG14217-RD, transcript variant D (Tao-1), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_143030.2  CG18410-RA (CG18410), mRNA 
0   NM_168144.1  CG32409-RA (CG32409), mRNA 
0   NM_133049.1  CG5988-RA (upd2), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   NM_206479.1  CG5196-RB, transcript variant B (CG5196), mRNA 
0   NM_141934.1  CG5196-RA, transcript variant A (CG5196), mRNA 
0   10  NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_057918.3  CG8048-RA, transcript variant A (Vha44), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.