National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8058R-1 
 Symbol CG8058  Full Name CG8058 
 CG No CG8058  Old CG No CG8058 
 Synonyms CG8058 
 Accession No (Link to NCBI) NM_136615.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTACTTGGCCCAGTGCACG 
 Primer Seq. 3'
aatctagaggtaccCTCCCCGCCATCTTTCAGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTACTTGG CCCAGTGCAC GACATTCGCT GCCTGTCCGC CGGAAGAGGC GTCTATCAGC 
0061 GGCAGTCCCG GTCGCAATCG CAGTCGCAGT CACAGGCTCC AGAGACCCAG CCCACCGTCC 
0121 AGACCTGCTC TCGCTTTCCC GTCCAGCATT AAGTTCGAAA TTGTCTGTGC GGAGCCTTCA 
0181 CTCAGAGAAT GACGCCATGT TCTACTCGAT GTACGCCTAC CTGTCCAACC TGCCGCGCCT 
0241 CCATGTTTTG GGCATGGCTG TGGTGGCCTA CGTCGTCTAT TACCTTATCC AGGTGGTCAA 
0301 GCGACCGATA ATCGCATGTT CGGACGGGCC GTTCAAGCAG TATCTGATCC GGAAGGTGCC 
0361 GACGCTGGAG AACAAGTACT GGCCCACCTT TTGGTGTGTG GAGAGTCGTG CCCAGACCGT 
0421 CCTTGCGAGC CtgCTGCGCT CCAAGAGTCT GCCGCGCGTC AACTACCGCC GTGAGATACT 
0481 CTCGCTGAAA GATGGCGGGG AG 
 in silico PCR Fragment
0001 AGCTACTTGG CCCAGTGCAC GACATTCGCT GCCTGTCCGC CGGAAGAGGC GTCTATCAGC 
0061 GGCAGTCCCG GTCGCAATCG CAGTCGCAGT CACA-GCTCC AGA-ACCCAG CCCACCGTCC 
0121 AGACCTGCTC TCGCTTTCCC GTCCAGCATT AAGTTCGAAA TTGTCTGTGC GGAGCCTTCA 
0181 CTCAGAGAAC GACGCCATGT TCTACTCGAT GTACGCCTAC CTGTCCAACC TGCCGCGCCT 
0241 CCATGTTTTG GGCATGGCTG TGGTGGCCTA CGTCGTCTAT TACCTTATCC AGGTGGTCAA 
0301 GCGACCGATA ATCGCATGTT CGGACGGGCC GTTCAAGCAG TATCTGATCC GGAAGGTGCC 
0361 GACGCTGGAG AACAAGTACT GGCCCACCTT TTGGTGTGTG GAGAGTCGTG CCCAGACCGT 
0421 CCTTGCGAGC CTGCTGCGCT CCAAGAGTCT GCCGCGCGTC AACTACCGCC GTGAGATACT 
0481 CTCGCTGAAA GATGGCGGGG AG 
 Assemble Data

8058R-1.IR_full       1   AGCTACTTGGCCCAGTGCACGACATTCGCTGCCTGTCCGCCGGAAGAGGCGTCTATCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     1   AGCTACTTGGCCCAGTGCACGACATTCGCTGCCTGTCCGCCGGAAGAGGCGTCTATCAGC 60


8058R-1.IR_full       61  GGCAGTCCCGGTCGCAATCGCAGTCGCAGTCACAGGCTCCAGAGACCCAGCCCACCGTCC 120
                          |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||
8058R-1.in silico     61  GGCAGTCCCGGTCGCAATCGCAGTCGCAGTCACA-GCTCCAGA-ACCCAGCCCACCGTCC 120


8058R-1.IR_full       121 AGACCTGCTCTCGCTTTCCCGTCCAGCATTAAGTTCGAAATTGTCTGTGCGGAGCCTTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     121 AGACCTGCTCTCGCTTTCCCGTCCAGCATTAAGTTCGAAATTGTCTGTGCGGAGCCTTCA 180


8058R-1.IR_full       181 CTCAGAGAATGACGCCATGTTCTACTCGATGTACGCCTACCTGTCCAACCTGCCGCGCCT 240
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     181 CTCAGAGAACGACGCCATGTTCTACTCGATGTACGCCTACCTGTCCAACCTGCCGCGCCT 240


8058R-1.IR_full       241 CCATGTTTTGGGCATGGCTGTGGTGGCCTACGTCGTCTATTACCTTATCCAGGTGGTCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     241 CCATGTTTTGGGCATGGCTGTGGTGGCCTACGTCGTCTATTACCTTATCCAGGTGGTCAA 300


8058R-1.IR_full       301 GCGACCGATAATCGCATGTTCGGACGGGCCGTTCAAGCAGTATCTGATCCGGAAGGTGCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     301 GCGACCGATAATCGCATGTTCGGACGGGCCGTTCAAGCAGTATCTGATCCGGAAGGTGCC 360


8058R-1.IR_full       361 GACGCTGGAGAACAAGTACTGGCCCACCTTTTGGTGTGTGGAGAGTCGTGCCCAGACCGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     361 GACGCTGGAGAACAAGTACTGGCCCACCTTTTGGTGTGTGGAGAGTCGTGCCCAGACCGT 420


8058R-1.IR_full       421 CCTTGCGAGCCTGCTGCGCTCCAAGAGTCTGCCGCGCGTCAACTACCGCCGTGAGATACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8058R-1.in silico     421 CCTTGCGAGCCTGCTGCGCTCCAAGAGTCTGCCGCGCGTCAACTACCGCCGTGAGATACT 480


8058R-1.IR_full       481 CTCGCTGAAAGATGGCGGGGAG 502
                          ||||||||||||||||||||||
8058R-1.in silico     481 CTCGCTGAAAGATGGCGGGGAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136615.2  CG8058-RA (CG8058), mRNA 
1.24   21  NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
1.24   21  NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 
0   14  13  NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_168897.1  CG32439-RA (CG32439), mRNA 
0   17  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0   17  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0   10  NM_078586.3  CG4070-RA, transcript variant A (Tis11), mRNA 
0   10  NM_167333.2  CG4070-RB, transcript variant B (Tis11), mRNA 
0   NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   NM_142734.1  CG6656-RA (CG6656), mRNA 
0   14  33  NM_078870.2  CG7157-RA (Acp36DE), mRNA 
0   38  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_164732.1  CG11266-RC, transcript variant C (CG11266), mRNA 
0   NM_164730.1  CG11266-RA, transcript variant A (CG11266), mRNA 
0   NM_164735.1  CG11266-RG, transcript variant G (CG11266), mRNA 
0   NM_164734.1  CG11266-RF, transcript variant F (CG11266), mRNA 
0   NM_164733.1  CG11266-RD, transcript variant D (CG11266), mRNA 
0   NM_135251.2  CG11266-RB, transcript variant B (CG11266), mRNA 
0   NM_164731.1  CG11266-RE, transcript variant E (CG11266), mRNA 
0   NM_079773.2  CG11853-RA (to), mRNA 
0   NM_130624.2  CG16903-RA (CG16903), mRNA 
0   11  18  NM_080531.2  CG5481-RA (lea), mRNA 
0   12  NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_078612.2  CG8470-RA (mRpS30), mRNA 
0   21  NM_141134.1  CG11440-RA (CG11440), mRNA 
0   19  NM_141742.2  CG6312-RA (Rfx), mRNA 
0   15  NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   10  NM_166391.1  CG13870-RB, transcript variant B (CG13870), mRNA 
0   10  NM_137634.1  CG13870-RA, transcript variant A (CG13870), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.