National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8057R-2 
 Symbol alc  Full Name alicorn 
 CG No CG8057  Old CG No CG8057 
 Synonyms FBgn0033383, alc, CG8057 
 Accession No (Link to NCBI) NM_136616.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTCCTCCGTGCACATGCAA 
 Primer Seq. 3'
aatctagaggtaccGAGATGGTGACGTTCTTGCCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTCCTCCG TGCACATGCA ACgNGAGCGC CACAAGTCGA CCGACTTGTC CACGCCGAGC 
0061 TCTCCCGCAC ATTTCCGCGA TTCGATTGGT GGAGGAGGAG CGGGACAGGC CGGGAGTGCT 
0121 GGCGCAGCAG TTCTGGGCGC TGCAGCGGGG GCGGTGGGAG CTGCGGGGGG TGGAGGAGGA 
0181 GGCGGCGGAG NCCAAGCTTT CTCGTTCGAC AAAAAACATA CGGCAGTCTT GAACGAGGGC 
0241 TCGTCGCAAG AAGACGACGA CCCGTACTAC ACGGGAACTG GAACTGGATC CACTAGATGA 
0301 GGCACCGCAC ACGACGACGC GACATCAGCT GTTACCCGAG ACCACTCCAG CATGGACAAC 
0361 AACGAGGAGG AGGAGGAGGC AGCGGCAGGA GCGGAGCCAG CGACTGGATC TCAGTTAACC 
0421 GGCGATGAGG ACGACATCCG GAAGACgGCA CTGCCCACAG TTCTGCGGTG GGACGGCGGC 
0481 GGCAAGAACG TCACCATCTC  
 in silico PCR Fragment
0001 AGCTCCTCCG TGCACATGCA ACGCGAGCGC CACAAGTCGA CCGACTTGTC CACGCCGAGC 
0061 TCTCCCGCAC ATTTCCGCGA TTCGATTGGT GGAGGAGGAG CGGGACAGGG CGGGAGTGCT 
0121 GGCGCAGCAG CTCTGGGCGC TGCAGCGGGG GCGGTGGGAG CTGCGGGGGG TGGAGGAGGA 
0181 GGCGGCGGAG GCCAAGCTTT CTCGTTCGAC AAAAAACATA CGGCAGTCTT GAACGAGGGC 
0241 TCGTCGCAAG AAGACGACGA CCCGTACTAC ACGGGAACTG GAACTGGATC CACTAGACGA 
0301 GGCACCGCAC ACGACGACGC GACATCAGCT GTTACCCGAG ACCACTCCAG CATGGACAAC 
0361 AACGAGGAGG AGGAGGAGGC AGCGGTAGGA GCGGAGCCAG CGACTGGATC TCAGTTAACC 
0421 GGCGATGAGG ACGACATCCG GAAGACGGCA CTGCCCACAG TTCTGCGGTG GGACGGCGGC 
0481 GGCAAGAACG TCACCATCTC  
 Assemble Data

8057R-2.IR_full       1   AGCTCCTCCGTGCACATGCAACGNGAGCGCCACAAGTCGACCGACTTGTCCACGCCGAGC 60
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
8057R-2.in silico     1   AGCTCCTCCGTGCACATGCAACGCGAGCGCCACAAGTCGACCGACTTGTCCACGCCGAGC 60


8057R-2.IR_full       61  TCTCCCGCACATTTCCGCGATTCGATTGGTGGAGGAGGAGCGGGACAGGCCGGGAGTGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
8057R-2.in silico     61  TCTCCCGCACATTTCCGCGATTCGATTGGTGGAGGAGGAGCGGGACAGGGCGGGAGTGCT 120


8057R-2.IR_full       121 GGCGCAGCAGTTCTGGGCGCTGCAGCGGGGGCGGTGGGAGCTGCGGGGGGTGGAGGAGGA 180
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
8057R-2.in silico     121 GGCGCAGCAGCTCTGGGCGCTGCAGCGGGGGCGGTGGGAGCTGCGGGGGGTGGAGGAGGA 180


8057R-2.IR_full       181 GGCGGCGGAGNCCAAGCTTTCTCGTTCGACAAAAAACATACGGCAGTCTTGAACGAGGGC 240
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
8057R-2.in silico     181 GGCGGCGGAGGCCAAGCTTTCTCGTTCGACAAAAAACATACGGCAGTCTTGAACGAGGGC 240


8057R-2.IR_full       241 TCGTCGCAAGAAGACGACGACCCGTACTACACGGGAACTGGAACTGGATCCACTAGATGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
8057R-2.in silico     241 TCGTCGCAAGAAGACGACGACCCGTACTACACGGGAACTGGAACTGGATCCACTAGACGA 300


8057R-2.IR_full       301 GGCACCGCACACGACGACGCGACATCAGCTGTTACCCGAGACCACTCCAGCATGGACAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8057R-2.in silico     301 GGCACCGCACACGACGACGCGACATCAGCTGTTACCCGAGACCACTCCAGCATGGACAAC 360


8057R-2.IR_full       361 AACGAGGAGGAGGAGGAGGCAGCGGCAGGAGCGGAGCCAGCGACTGGATCTCAGTTAACC 420
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
8057R-2.in silico     361 AACGAGGAGGAGGAGGAGGCAGCGGTAGGAGCGGAGCCAGCGACTGGATCTCAGTTAACC 420


8057R-2.IR_full       421 GGCGATGAGGACGACATCCGGAAGACGGCACTGCCCACAGTTCTGCGGTGGGACGGCGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8057R-2.in silico     421 GGCGATGAGGACGACATCCGGAAGACGGCACTGCCCACAGTTCTGCGGTGGGACGGCGGC 480


8057R-2.IR_full       481 GGCAAGAACGTCACCATCTC 500
                          ||||||||||||||||||||
8057R-2.in silico     481 GGCAAGAACGTCACCATCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  38  NM_136616.3  CG8057-RA, transcript variant A (CG8057), mRNA 
53.52   258  17  NM_206061.1  CG8057-RB, transcript variant B (CG8057), mRNA 
0.62   11  16  NM_132074.1  CG3585-RA (CG3585), mRNA 
0.2   27  NM_134474.4  CG32532-RA (CG32532), mRNA 
0.2   13  NM_130607.2  CG11596-RA, transcript variant A (CG11596), mRNA 
0.2   13  NM_166916.1  CG11596-RC, transcript variant C (CG11596), mRNA 
0.2   NM_166248.1  CG5033-RB, transcript variant B (CG5033), mRNA 
0.2   13  NM_135861.1  CG15287-RA (CG15287), mRNA 
0.2   NM_137426.2  CG5033-RA, transcript variant A (CG5033), mRNA 
0   11  34  51  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
0   11  34  51  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   10  44  94  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   10  40  93  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   10  30  59  NM_141129.1  CG11523-RA (CG11523), mRNA 
0   31  36  NM_137995.2  CG18426-RA (ytr), mRNA 
0   14  23  NM_142874.2  CG6747-RA (Ir), mRNA 
0   24  26  NM_206782.1  CG6103-RD, transcript variant D (CrebB-17A), mRNA 
0   24  26  NM_206784.1  CG6103-RE, transcript variant E (CrebB-17A), mRNA 
0   24  26  NM_206781.1  CG6103-RF, transcript variant F (CrebB-17A), mRNA 
0   24  26  NM_206783.1  CG6103-RG, transcript variant G (CrebB-17A), mRNA 
0   13  NM_079564.3  CG8874-RA, transcript variant A (Fps85D), mRNA 
0   NM_169276.1  CG8874-RD, transcript variant D (Fps85D), mRNA 
0   13  16  NM_132121.2  CG3135-RA (shf), mRNA 
0   34  NM_165841.1  CG9015-RB, transcript variant B (en), mRNA 
0   34  NM_078976.3  CG9015-RA, transcript variant A (en), mRNA 
0   15  37  NM_132356.1  CG15247-RA (CG15247), mRNA 
0   35  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   15  23  NM_141665.2  CG8348-RA (Dh), mRNA 
0   13  37  NM_136191.2  CG31688-RA (CG31688), mRNA 
0   26  65  NM_167309.1  CG32663-RA (CG32663), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.