National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8053R-2 
 Symbol eIF-1A  Full Name Eukaryotic initiation factor 1A 
 CG No CG8053  Old CG No CG8053 
 Synonyms eIF1A, group I, Group I, CG8053, D-eIF1A, eIF-4c, D-eIF4c, anon-EST:Liang-2.3, clone 2.3, EP(3)0935, EP935, anon-EST:Posey4, eIF-1A 
 Accession No (Link to NCBI) NM_079989.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGTCGTCGTGGTAAGAACGAGAACGAGTTCGAGAAGCGTGAGCTGATCTTCAAGGAGGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAACAGGAGTACGCGCAGGTGACCAAGATGCTGGGCAACGGTCGTCTGGAGGCAATGTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTTGATGGCGTCAAACGCCTGTGTCACATTCGGGGGAAACTTCGCAAGAAGGTGTGGATT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AACCAGGGCGACATCATATTGGTGGGCTTGCGTGACTACCAGGACTCGAAGGCTGATGTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCCTCAAATACACACCGGACGAGGCCAGGAACCTGAAGACGTACGGCGAGTTCCCCGAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGGTGCGCATCAACGAGACAGTCACATTCGTGGAGGATGGCTTCGACGAGGACATCGAG 360

                          ||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTCGGCGATGAGATCAGCTCCGAGGATGACGCCGACTCCGTGGACAA 407

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   389  NM_206509.1  CG8053-RB, transcript variant B (eIF-1A), mRNA 
100   389  NM_079989.2  CG8053-RA, transcript variant A (eIF-1A), mRNA 
0   NM_137064.2  CG10808-RA (synaptogyrin), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_135968.1  CG13280-RA (CG13280), mRNA 
0   NM_141198.3  CG9776-RA, transcript variant A (CG9776), mRNA 
0   NM_057948.2  CG5183-RA, transcript variant A (KdelR), mRNA 
0   NM_164927.1  CG5183-RB, transcript variant B (KdelR), mRNA 
0   NM_164928.1  CG5183-RC, transcript variant C (KdelR), mRNA 
0   16  NM_138121.2  CG16932-RA, transcript variant A (Eps-15), mRNA 
0   10  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 
0   NM_206235.1  CG13921-RB, transcript variant B (CG13921), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_167264.1  CG2061-RB, transcript variant B (CG2061), mRNA 
0   NM_132454.4  CG2061-RA, transcript variant A (CG2061), mRNA 
0   NM_167265.1  CG2061-RC, transcript variant C (CG2061), mRNA 
0   NM_132753.1  CG9514-RA (CG9514), mRNA 
0   NM_132543.1  CG10362-RA (CG10362), mRNA 
0   NM_079564.3  CG8874-RA, transcript variant A (Fps85D), mRNA 
0   NM_169274.1  CG8874-RB, transcript variant B (Fps85D), mRNA 
0   NM_169275.1  CG8874-RC, transcript variant C (Fps85D), mRNA 
0   NM_168335.1  CG4035-RD, transcript variant D (eIF-4E), mRNA 
0   NM_168333.1  CG4035-RC, transcript variant C (eIF-4E), mRNA 
0   NM_080090.2  CG4035-RB, transcript variant B (eIF-4E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.