National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8053R-1 
 Symbol eIF-1A  Full Name Eukaryotic initiation factor 1A 
 CG No CG8053  Old CG No CG8053 
 Synonyms eIF1A, group I, Group I, CG8053, D-eIF1A, eIF-4c, D-eIF4c, anon-EST:Liang-2.3, clone 2.3, EP(3)0935, EP935, anon-EST:Posey4, eIF-1A 
 Accession No (Link to NCBI) NM_079989.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTCGTCGTGGTAAGAACGAG 
 Primer Seq. 3'
aatctagaggtaccTTGTCCACGGAGTCGGCGTCA 
 Predicted Fragment Size
407 
 IR fragment full Seq
0001 CGTCGTCGTG GTAAGAACGA GAACGAGTTC GAGAAGCGTG aGCTGATCTT CAAGGAGGAC 
0061 CAACAGGAGT ACGCGCAGGT GACCAAGATG CTGGGCAACG GTCGTCTGGA GGCAATGTGC 
0121 TTTGATGGCG TCAAACGCCT GTGTCACATT CGGGGGAAAC TTCGCAAGAA GGTGTGGATT 
0181 AACCAGGGCG ACATCATATT GGTGGGCTTG CGTGACTACC AGGACTCGAA GGCTGATGTG 
0241 ATCCTCAAAT ACACACCGGA CGAGGCCAGG AACCTGAAGA CGTACGGCGA GTTCCCCGAG 
0301 TCGGTGCGCA TCAACGAGAC AGTCACATTC GTGGAGGATG GCTTCGACGA GGACATCGAG 
0361 TTCGGCGATG AGATCAGCTC CGAGGATGAC GCCGACTCCG TGGACAA 
 in silico PCR Fragment
0001 CGTCGTCGTG GTAAGAACGA GAACGAGTTC GAGAAGCGTG AGCTGATCTT CAAGGAGGAC 
0061 CAACAGGAGT ACGCGCAGGT GACCAAGATG CTGGGCAACG GTCGTCTGGA GGCAATGTGC 
0121 TTTGATGGCG TCAAACGCCT GTGTCACATT CGGGGGAAAC TTCGCAAGAA GGTGTGGATT 
0181 AACCAGGGCG ACATCATATT GGTGGGCTTG CGTGACTACC AGGACTCGAA GGCTGATGTG 
0241 ATCCTCAAAT ACACACCGGA CGAGGCCAGG AACCTGAAGA CGTACGGCGA GTTCCCCGAG 
0301 TCGGTGCGCA TCAACGAGAC AGTCACATTC GTGGAGGATG GCTTCGACGA GGACATCGAG 
0361 TTCGGCGATG AGATCAGCTC CGAGGATGAC GCCGACTCCG TGGACAA 
 Assemble Data

8053R-1.IR_full       1   CGTCGTCGTGGTAAGAACGAGAACGAGTTCGAGAAGCGTGAGCTGATCTTCAAGGAGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     1   CGTCGTCGTGGTAAGAACGAGAACGAGTTCGAGAAGCGTGAGCTGATCTTCAAGGAGGAC 60


8053R-1.IR_full       61  CAACAGGAGTACGCGCAGGTGACCAAGATGCTGGGCAACGGTCGTCTGGAGGCAATGTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     61  CAACAGGAGTACGCGCAGGTGACCAAGATGCTGGGCAACGGTCGTCTGGAGGCAATGTGC 120


8053R-1.IR_full       121 TTTGATGGCGTCAAACGCCTGTGTCACATTCGGGGGAAACTTCGCAAGAAGGTGTGGATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     121 TTTGATGGCGTCAAACGCCTGTGTCACATTCGGGGGAAACTTCGCAAGAAGGTGTGGATT 180


8053R-1.IR_full       181 AACCAGGGCGACATCATATTGGTGGGCTTGCGTGACTACCAGGACTCGAAGGCTGATGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     181 AACCAGGGCGACATCATATTGGTGGGCTTGCGTGACTACCAGGACTCGAAGGCTGATGTG 240


8053R-1.IR_full       241 ATCCTCAAATACACACCGGACGAGGCCAGGAACCTGAAGACGTACGGCGAGTTCCCCGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     241 ATCCTCAAATACACACCGGACGAGGCCAGGAACCTGAAGACGTACGGCGAGTTCCCCGAG 300


8053R-1.IR_full       301 TCGGTGCGCATCAACGAGACAGTCACATTCGTGGAGGATGGCTTCGACGAGGACATCGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     301 TCGGTGCGCATCAACGAGACAGTCACATTCGTGGAGGATGGCTTCGACGAGGACATCGAG 360


8053R-1.IR_full       361 TTCGGCGATGAGATCAGCTCCGAGGATGACGCCGACTCCGTGGACAA 407
                          |||||||||||||||||||||||||||||||||||||||||||||||
8053R-1.in silico     361 TTCGGCGATGAGATCAGCTCCGAGGATGACGCCGACTCCGTGGACAA 407

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   389  NM_206509.1  CG8053-RB, transcript variant B (eIF-1A), mRNA 
100   389  NM_079989.2  CG8053-RA, transcript variant A (eIF-1A), mRNA 
0   NM_137064.2  CG10808-RA (synaptogyrin), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_135968.1  CG13280-RA (CG13280), mRNA 
0   NM_141198.3  CG9776-RA, transcript variant A (CG9776), mRNA 
0   NM_057948.2  CG5183-RA, transcript variant A (KdelR), mRNA 
0   NM_164927.1  CG5183-RB, transcript variant B (KdelR), mRNA 
0   NM_164928.1  CG5183-RC, transcript variant C (KdelR), mRNA 
0   16  NM_138121.2  CG16932-RA, transcript variant A (Eps-15), mRNA 
0   10  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 
0   NM_206235.1  CG13921-RB, transcript variant B (CG13921), mRNA 
0   NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_167264.1  CG2061-RB, transcript variant B (CG2061), mRNA 
0   NM_132454.4  CG2061-RA, transcript variant A (CG2061), mRNA 
0   NM_167265.1  CG2061-RC, transcript variant C (CG2061), mRNA 
0   NM_132753.1  CG9514-RA (CG9514), mRNA 
0   NM_132543.1  CG10362-RA (CG10362), mRNA 
0   NM_079564.3  CG8874-RA, transcript variant A (Fps85D), mRNA 
0   NM_169274.1  CG8874-RB, transcript variant B (Fps85D), mRNA 
0   NM_169275.1  CG8874-RC, transcript variant C (Fps85D), mRNA 
0   NM_168335.1  CG4035-RD, transcript variant D (eIF-4E), mRNA 
0   NM_168333.1  CG4035-RC, transcript variant C (eIF-4E), mRNA 
0   NM_080090.2  CG4035-RB, transcript variant B (eIF-4E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.